Microbiota
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1256838 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:v3-v4 16S rRNA sequencing was used to characterize both gut and oral microbiota composition of RCC (refractory chronic cough) patients and matched healthy controls (HC). The groups are matched in age and gender.
2024-04-17 | GSE240646 | GEO
Project description:Ulcerative colitis (UC) is a chronic inflammatory disease of the colon, associated with gut microbiota dysbiosis. While global studies have explored this link, region-specific microbial profiles remain underreported. This pilot study aimed to characterize and compare, for the first time, the gut microbiota of Lebanese UC patients and healthy controls using 16S rRNA gene sequencing (V3–V4 region). Fecal samples from 11 UC patients and 11 healthy individuals were analyzed. Alpha and beta diversity metrics were computed, and gut microbial composition was assessed across taxonomic levels. Statistical comparisons used Mann-Whitney and Fisher’s exact tests. UC patients showed significantly reduced microbial diversity based on Faith’s Phylogenetic Diversity and Shannon index (p < 0.05), though evenness was unaffected. Beta diversity also revealed significant group-level dissimilarities (p < 0.05). At the phylum level, Bacteroidota was elevated in UC, while Bacillota and Actinomycetota were reduced. Genera such as Ruminococcus, Fusicatenibacter, Mediterraneibacter, Eubacterium, and Coprococcus were depleted in UC. Faecalibacterium, commonly reduced in UC, showed no significant difference. This first analysis of gut microbiota in Lebanese UC patients reveals a distinct microbial signature that partially diverges from global trends, supporting the need for region-specific microbiome studies and personalized microbiota-targeted therapies.
2025-11-27 | GSE303706 | GEO
Project description:To determine microbiota composition associated with loss of KDM5 in intestine, we carried out 16S rRNA seq analyses of dissected intestine from wildtype and kdm5 mutant. [GSM2628181-GSM2628190]. A total of 78 operational taxonomic units (OTUs) were identified in the sequence data. There were about 15 genera much less abundant in kdm5 mutant compared to wildtype. The kdm5 mutant were sensitive to pathogen. To confirm the microbiota associated with loss of KDM5 in intestine, 16S rRNA of new flies were sequenced and analyzed by Majorbio Bio-Pharm Technology Co. Ltd. (Shanghai, China) [GSM3243472-GSM3243481]. A total of 107 operational taxonomic units (OTUs) were identified in the sequence data. There were about 20 genera much less abundant in kdm5 mutant compared to wildtype. To confirm the microbiota associated with loss of KDM5 drosophila feeding with Lactobacillus plantarum, 16S rRNA of kdm5 mutant flies were sequenced and analyzed by Novogene Bioinformatics Technology Co., Ltd. (Tianjin, China) [GSM3263522-GSM3263527]. A total of 92 operational taxonomic units (OTUs) were identified in the sequence data. To confirm the microbiota associated with KDM5 knockdown in intestine, 16S rRNA of Myo1A-Gal4TS/+ and Myo1A-Gal4TS/+;+/kdm5RNAi flies were sequenced and analyzed by Biomarker Co. Ltd. (Beijing, China). [GSM3507915-GSM3507924]. A total of 50 operational taxonomic units (OTUs) were identified in the sequence data. There was a significant different based on the genus level between two groups.
2019-02-08 | GSE98944 | GEO
Project description:An increasing body of evidence suggests an important role of the human microbiome in health and disease. We propose a ‘lost and found’ pipeline, which examines high quality unmapped sequence reads for microbial taxonomic classification. Using this pipeline, we are able to detect bacterial and archaeal phyla in blood using RNA sequencing (RNA-Seq) data. Careful analyses, including the use of positive and negative control datasets, suggest that these detected phyla represent true microbial communities in whole blood and are not due to contaminants. We applied our pipeline to study the composition of microbial communities present in blood across 192 individuals from four subject groups: schizophrenia (n=48), amyotrophic lateral sclerosis (n=47), bipolar disorder (n=48) and healthy controls (n=49). We observe a significantly increased microbial diversity in schizophrenia compared to the three other groups and replicate this finding in an independent schizophrenia case-control study. Our results demonstrate the potential use of total RNA to study microbes that inhabit the human body.
2016-05-25 | GSE80974 | GEO
Project description:Analysis of gingival crevicular fluid (GCF) samples may give information of the identity of unattached (planktonic) subgingival bacteria, the 35 forefront candidates for systemic dispersal via ulcerated periodontal pocket epithelium. Our study represents the first one targeting the identity of bacteria in gingival crevicular fluid. Methodology/Principal findings: We determined bacterial species diversity in GCF samples of a group of periodontitis patients and delineated contributing bacterial and host-associated factors. Subgingival paper point (PP) samples from the same sites were taken for comparison. After DNA extraction, 16S rRNA genes were PCR amplified and DNA-DNA hybridization was performed using a microarray for over 300 bacterial species or groups. Altogether 133 species from 41 genera and 8 phyla 45 were detected with 9 to 62 and 18 to 64 species in GCF and PP samples, respectively, 46 per patient. Projection to latent structures by means of partial least squares (PLS) was applied to the multivariate data analysis. PLS regression analysis showed that species of genera including Campylobacter, Selenomonas, Porphyromonas, Catonella, Tannerella, Dialister, Peptostreptococcus, Streptococcus and Eubacterium had significant positive correlations and the number of teeth with low-grade attachment loss a significant negative correlation to species diversity in GCF samples. OPLS/O2PLS discriminant analysis revealed significant positive correlations to GCF sample group membership for species of genera Campylobacter, Leptotrichia, Prevotella, Dialister, Tannerella, Haemophilus, Fusobacterium, Eubacterium, and Actinomyces. Conclusions/Significance: Among a variety of detected species those traditionally classified as Gram-negative anaerobes growing in mature subgingival biofilms were the main predictors for species diversity in GCF samples as well as responsible for distinguishing GCF samples from PP samples. GCF bacteria may provide new prospects for studying dynamic properties of subgingival biofilms. The microbial profiles of GCF and subgingival plaque were analyzed from 17 subjects with periodontal disease.
2010-05-21 | E-GEOD-21929 | biostudies-arrayexpress
Project description:16S rRNA V3-V4 amplicon sequencing was performed on fecal samples from 12 male C57BL/6J mice across three groups (4 replicates each): Control (distilled water, 3 days), Model (distilled water, 3 days + APAP 300 mg/kg i.p.), and PoH (PO extract 3 g/kg p.o. daily for 3 days + APAP 300 mg/kg i.p.). Sequencing was performed on an Illumina NovaSeq 6000 platform using paired-end 250bp reads.
2026-07-07 | GSE337417 | GEO
Project description:v3-v4 16S rRNA sequencing was used to characterize the differences in microbiota between specimens of breast cancer and healthy surrounding tissue in adult Algerian females
2025-07-30 | GSE243440 | GEO
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.
2022-04-02 | GSE199749 | GEO
Project description:Total DNA was extracted from stool specimens, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.
2022-08-24 | GSE206807 | GEO