Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1265438 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:To identify senescence-regulation of miRNAs in Arabidopsis thaliana, eight small RNA libraries were constructed and sequenced at four different stages of development and senescence from both leaves and siliques. Parallel Analysis of RNA Ends (PARE) libraries were also constructed and sequenced to enable the large-scale examination of miRNA-guided cleavage products.
2014-09-08 | GSE55151 | GEO
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:To identify senescence-regulation of miRNAs in Arabidopsis thaliana, eight small RNA libraries were constructed and sequenced at four different stages of development and senescence from both leaves and siliques. Parallel Analysis of RNA Ends (PARE) libraries were also constructed and sequenced to enable the large-scale examination of miRNA-guided cleavage products. Genome-wide small RNA profiling was done by Illumina TruSeq sample preparation followed by high-throughput sequencing with Illumina HiSeq 2000 platform.
2014-09-08 | E-GEOD-55151 | biostudies-arrayexpress
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage.
2015-03-04 | GSE61099 | GEO
Project description:RNA-guided nucleases (RGNs) based on CRISPR systems permit installing short and large edits within eukaryotic genomes. However, precise genome editing is often hindered due to nuclease off- target activities and the multiple-copy character of the vast majority of chromosomal sequences. Dual nicking RGNs and high-specificity RGNs both exhibit low off-target activities. Here, we report that high-specificity Cas9 nucleases are convertible into nicking Cas9D10A variants whose precision is superior to that of the commonly used Cas9D10A nickase. Dual nicking RGNs based on a selected group of these Cas9D10A variants can yield gene knockouts and gene knock-ins at frequencies similar to or higher than those achieved by their conventional counterparts. Moreover, high-specificity dual nicking RGNs are capable of distinguishing highly similar sequences by “tiptoeing” over pre-existing single base-pair polymorphisms. Finally, high-specificity RNA-guided nicking complexes generally preserve genomic integrity, as demonstrated by unbiased genome-wide high-throughput sequencing assays. Thus, in addition to substantially enlarging the Cas9 nickase toolkit, we demonstrate the feasibility in expanding the range and precision of genome editing procedures. The herein introduced tools and multi-tier high-specificity genome editing strategies might be particularly beneficial whenever predictability and/or safety of genetic manipulations are paramount.
2020-12-08 | GSE153471 | GEO
Project description:The clustered regularly interspaced short palindromic repeat (CRISPR)-associated enzyme Cas9 is an RNA-guided nuclease that has been widely adapted for genome editing in eukaryotic cells. However, the in vivo target specificity of Cas9 is poorly understood and most studies rely on in silico predictions to define the potential off-target editing spectrum. Using chromatin immunoprecipitation followed by sequencing (ChIP-seq), we delineate the genome-wide binding panorama of catalytically inactive Cas9 directed by two different single guide (sg) RNAs targeting the Trp53 locus. Cas9:sgRNA complexes are able to load onto multiple sites with short seed regions adjacent to 5’NGG3’ protospacer adjacent motifs (PAM). Examination of dmCas9 binding sites using two Trp53 targeting sgRNAs in Arf -/- MEF cell line (mouse).
2014-08-29 | E-GEOD-57650 | biostudies-arrayexpress
Project description:Cas9, a CRISPR RNA-guided nuclease, has been rapidly adopted as a tool for biochemical and genetic manipulation of DNA. Although Cas9 offers remarkable specificity and versatility for genome manipulation, mis-targeted events occur. To extend the understanding of Cas9 target::homology requirements, we compared mismatch tolerance for a specific Cas9::gRNA complex in vitro and in vivo (in Saccharomyces cerevisiae). A variety of truncated and full-length gRNAs (with 17, 18, and 20 nucleotides of complementarity sequence) were used. In each case, we observed notable differences between in vitro and in vivo Cas9 cleavage specificity profiles, with a more stringent effect of mismatches on activity seen in vivo. Increased specificity of the 18 nt complementarity truncated gRNA was evident in vivo, but not in vitro. Overall, this study highlights differences in the specificity of Cas9 cleavage between controlled in vitro conditions and complex and chromatinized in vivo conditions.
2016-06-10 | GSE79667 | GEO
Project description:Bacteria encode diverse defense systems including restriction-modification and CRISPR-Cas that cleave nucleic acid to protect against phage infection. Bioinformatic analyses demonstrate many recently identified anti-phage defense operons are comprised of a nuclease and NTPase protein, suggesting additional nucleic acid targeting systems remain to be understood. Here we develop large-scale comparative cell biology and biochemical approaches to analyze 16 nuclease-NTPase systems and define molecular features that control anti-phage defense. Purification, biochemical characterization, and in vitro reconstitution of nucleic acid degradation demonstrates protein–protein complex formation is a shared feature of multi-gene nuclease-NTPase systems. We show that AbpAB, Hachiman, and PD-T4-8 system nucleases use highly degenerate recognition site preferences to enable broad nucleic acid degradation, and the Azaca system exhibits specific phage targeting through the recognition of modified phage genomic DNA. Our results uncover principles of anti-phage defense system function and highlight the mechanistic diversity of nuclease-NTPase systems in bacterial immunity.
2026-02-18 | GSE303276 | GEO
Project description:The clustered regularly interspaced short palindromic repeat (CRISPR)-associated enzyme Cas9 is an RNA-guided nuclease that has been widely adapted for genome editing in eukaryotic cells. However, the in vivo target specificity of Cas9 is poorly understood and most studies rely on in silico predictions to define the potential off-target editing spectrum. Using chromatin immunoprecipitation followed by sequencing (ChIP-seq), we delineate the genome-wide binding panorama of catalytically inactive Cas9 directed by two different single guide (sg) RNAs targeting the Trp53 locus. Cas9:sgRNA complexes are able to load onto multiple sites with short seed regions adjacent to 5’NGG3’ protospacer adjacent motifs (PAM).
2014-08-29 | GSE57650 | GEO
Project description:During postnatal development, the optical geometry of the eye is refined through a process called emmetropization. During eye emmetropization, optical defocus triggers a signaling cascade that originates in the retina, propagates across other ocular tissues and results in scleral wall remodeling. This signaling is associated with large-scale changes in gene expression, which was extensively studied at the mRNA level. Although several studies investigated the role of non-coding RNAs in eye emmetropization, the role of microRNAs (miRNAs) and other non-coding RNAs remains poorly understood. We performed a genome-wide analysis of the miRNA-mRNA gene regulatory networks underlying optical-defocus-induced myopia using massive parallel RNA sequencing (RNA-seq). Our analysis revealed a widespread involvement of miRNAs in optical defocus perception and visually guided eye emmetropization underlying myopia development. We found that a relatively small number of miRNAs (39 miRNAs total) regulate expression of over 450 mRNAs, or 59% of all mRNAs differentially expressed in the eyes of mice with optical-defocus-induced myopia. MiRNAs were also found to be involved in the regulation of the absolute majority of the biological processes and signaling pathways underlying visually guided eye emmetropization and myopia.
2025-04-03 | GSE200048 | GEO