Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1315185 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Transposon insertion site sequencing (TIS) is a powerful method for associating genotype to phenotype. However, all TIS methods described to date use short nucleotide sequence reads which cannot uniquely determine the locations of transposon insertions within repeating genomic sequences where the repeat units are longer than the sequence read length. To overcome this limitation, we have developed a TIS method using Oxford Nanopore sequencing technology that generates and uses long nucleotide sequence reads; we have called this method LoRTIS (Long Read Transposon Insertion-site Sequencing). This experiment data contains sequence files generated using Nanopore and Illumina platforms. Biotin1308.fastq.gz and Biotin2508.fastq.gz are fastq files generated from nanopore technology. Rep1-Tn.fastq.gz and Rep1-Tn.fastq.gz are fastq files generated using Illumina platform. In this study, we have compared the efficiency of two methods in identification of transposon insertion sites.
2022-05-30 | E-MTAB-11351 | biostudies-arrayexpress
Project description:long-read CAGE was design to identify full length capped transcript across 10 specific loci in cortical neurones. Long-read CAGE was based on the Cap-Trapper method with the full length cDNA sequencing using ONT MinION sequencer. After RNA extraction, 10 µg total RNAs from Human iPS (WTC-11) cells, differentiated neural stem cells and differentiated cortical neuron cells were polyadenylated with E-coli poly(A) Polymerase (PAP) (NEB M0276) at 37°C for 15 min and purified with AMPure RNA Clean XP beads. The PAP treated 5 µg RNA was reverse transcribed with oligodT_16VN_UMI25_primer (GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNNNNNNNNNNNCTACGTTTTTTTTTTTTTTTTVN) and Prime Script II Reverse Transcriptase (Takara Bio) at 42°C for 60 min and purified with RNAClean XP beads. Cap-trapping from the RNA/cDNA hybrids was performed with published protocol (Takahashi et al., Nature protocols, 2012 (https://doi.org/10.1038/nprot.2012.005)), and RNA was digested with RNase H (Takara Bio) at 37°C for 30 min and purified with AMPureXP beads. 5’ linker (N6 up GTGGTATCAACGCAGAGTACNNNNNN-Phos, GN5 up GTGGTATCAACGCAGAGTACGNNNNN-Phos, down Phos-GTACTCTGCGTTGATACCAC-Phos) was ligated to the cDNA with Mighty Mix (Takara Bio) for overnight and the ligated cDNA was purified with AMPure XP beads. Shrimp Alkaline Phosphatase (Takara Bio) was used to remove phosphates at the ligated linker and purified with AMPureXP beads. The 5’ linker ligated cDNA was then second strand synthesized with KAPA HiFi mix (Roche) and 2nd synthesis primer_UMI15 at 95°C for 5 min, 55°C for 5 min and 72°C for 30 min. Exonuclease I (Takara Bio) was added for the primer digestion at 37°C for 30 min, and the cDNA/DNA hybrid was purified with AMPureXP and amplified with PrimerSTAR GXL DNA polymerase (Takara Bio) and PCR primer (fwd_CTACACTCGTCGGCAGCGTC, rev _GAGATGTCTCGTGGGCTCGG) for 7 cycles. The library was then treated with SQK-LSK110 (Oxford Nanopore Technologies) with manufacture’s protocol and sequenced with R9.4 flowcell (FLO-MIN106) in MinION sequencer. Basecalling was processed by Guppy v5.0.14 basecaller software provided by Oxford Nanopore Technologies to generate fastq files from FAST5 files. To prepare clean reads from fastq files, adapter sequence was trimmed by pychopper (https://github.com/nanoporetech/pychopper) with VNP_GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNCTACG and SSP_ CTACACTCGTCGGCAGCGTCNNNNNNNNNNNNNNNNNNNNNNNNNGTGGTATCAACGCAGAGTAC and the fastq was mapped on our target genes.
2024-10-08 | E-MTAB-14500 | biostudies-arrayexpress
Project description:Reference-free reconstruction and quantification of transcriptomes from Nanopore long-read sequencing (fastq files)
| PRJEB39835 | ENA
Project description:Tuberous sclerosis complex (TSC) is a relatively common autosomal dominant disorder characterized by multiple dysplastic organ lesions and neuropsychiatric symptoms, caused by loss-of-function mutation of either TSC1 or TSC2. Target-capture full-length double-stranded cDNA sequencing using long-read sequencer Nanopore (Nanopore Long-read Target Sequencing) revealed that the various kinds of the TSC1 and TSC2 full-length transcripts and the novel intron retention transcripts of TSC2 in TSC patient. Our results indicate that the Nanopore Long-read Target Sequencing is useful for the detection of mutations and confers information on the full-length alternative splicing transcripts for the genetic diagnosis.
2023-09-04 | GSE241410 | GEO
Project description:Nanopore long-read sequencing was used to generate a complete assembly of the Arabidopsis centromeres.
2021-04-02 | E-MTAB-10272 | biostudies-arrayexpress
Project description:Sequencing was performed to assess the ability of Nanopore direct cDNA and native RNA sequencing to characterise human transcriptomes. Total RNA was extracted from either HAP1 or HEK293 cells, and the polyA+ fraction isolated using oligodT dynabeads. Libraries were prepared using Oxford Nanopore Technologies (ONT) kits according to manufacturers instructions. Samples were then sequenced on ONT R9.4 flow cells to generate fast5 raw reads in the ONT MinKNOW software. Fast5 reads were then base-called using the ONT Albacore software to generate Fastq reads.
2019-03-14 | E-MTAB-7778 | biostudies-arrayexpress