Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Human metagenome

ABSTRACT: An Improved Dual-Indexing Approach for Multiplexed 16S Microbial Sequencing on the Illumina MiSeq Platform

PROVIDER: PRJNA203369 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR1027630.fastq.gz	Fastqsanger.gz
	SRR1027630_1.fastq.gz	Fastqsanger.gz
	SRR1027630_2.fastq.gz	Fastqsanger.gz
	SRR1028040.fastq.gz	Fastqsanger.gz
	SRR1025571_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 120

Similar Datasets

Evaluating the gut microbiota shifts caused by two diets based on ancient grains

Project description:Total DNA was extracted from stool specimens, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2022-08-24 | GSE206807 | GEO

Comparing the microbiota composition between Cocaine addicted and Healthy subjects and the corresponding shift caused by rTMS treatment.

Project description:Total DNA was extracted from saliva and stool of the patients, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2023-05-31 | GSE206765 | GEO

Microbial community structure of a lotic aquatic system receiving wastewater effluent

2016-01-01 | GSE73842 | GEO

Analysis of microbiota composition within breast tumor and healthy breast tissues in males and females

Project description:Total DNA was extracted from FFPE specimens of breast tumor and surrounding healthy tissue, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2023-06-14 | GSE212891 | GEO

Comparing the microbiota composition between HPV positive and negative patients with CRC

Project description:Total DNA was extracted from the stool of the patients, amplified to collect amplicons of variable V3–V4 regions (primers 341F and 805R) of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2023-10-15 | GSE216589 | GEO

Accessory subunits are integral for assembly and function of human mitochondrial complex I

Project description:For analysis of mRNA expression levels, total RNA was harvested from each cell-line in replicate with Trizol™ (Thermo scientific). Total RNA was purified using Direct-zol™ columns according to the manufacturers specifications (Zymo Research). For cDNA synthesis 1 μg of total RNA was process as the T12VN-PAT assay (Jänicke et al., RNA 2012), except that this was adapted for multiplexing on the Illumina MiSeq instrument. We refer to this assay as mPAT for multiplexed PAT. The approach is based on a nested-PCR that sequentially incorporates the Illumina platform’s flow-cell specific terminal extensions onto 3’ RACE PCR amplicons. First, cDNA was generated using the anchor primer mPAT Reverse, next this primer and a pool of 50 gene-specific primers were used in 5 cycles of amplification. Each gene-specific primer had a universal 5’ extension (see supplementary file primers) for sequential addition of the 5’ (P5) Illumina elements. These amplicons were then purified using NucleoSpin columns (Macherey-Nagel), and entered into second round amplification using the universal Illumina Rd1 sequencing Primer and TruSeq indexed reverse primers from Illumina. Second round amplification was for 14 cycles. Note, that each experimental condition was amplified separately in the first round with identical primers. In the second round, a different indexing primer was used for each experimental condition. All PCR reactions were pooled and run using the MiSeq Reagent Kit v2 with 300 cycles (i.e. 300 bases of sequencing) according to the manufacturers specifications. Data were analysed using established bioinformatics pipelines (Harrison et al., RNA 2015)

2016-09-08 | GSE84913 | GEO

16S rRNA sequencing analysis of bacteiral community composition in antibiotic-treated mouse fecal sample

Project description:Purpose: This study aims to compare and analyze the differences in bacterial community composition in fecal samples from mice treated with Control(DW), Vancomycin (VAN), Ampicillin (AMP), Neomycin (NEO), Metronidazole (MET), and a combination of all antibiotics (ALL, VANM) using 16S rRNA sequencing. Methods: Each antibiotics treated mice's fecal samples were collected and stored -80'c until analyzation. DNA was extracted using the NucleoSpin DNA Stool Kit (MACHEREY-NAGEL) following the manufacturer’s protocol. Metagenomic sequencing was performed on an Illumina MiSeq platform (Illumina), targeting the V3 and V4 regions of the 16S rRNA gene according to the manufacturer's instructions. PCR products were purified using AMPure XP beads, and sequencing adapters were added using the Nextera XT Index Kit (Illumina). The library was further purified with AMPure XP beads and quantified using automated electrophoresis with the TapeStation System (Agilent). Sequencing was performed using the MiSeq v3 reagent kit (Illumina), following the manufacturer’s protocol. Results: QIIME2 (v2023.02) was used to process and analyze 16S rRNA gene amplicon sequencing data, from sequence preprocessing to taxonomic classification. Paired-end sequences were merged and quality-filtered using Deblur. The resulting amplicon sequence variants (ASVs) were used for downstream analyses. Conclusions: Our study presents a comparative analysis of bacterial community composition in fecal samples from antibiotic-treated mice. We observed that microbiota composition varied distinctly depending on the type of antibiotic administered.

2026-01-28 | GSE291841 | GEO

ena-DATASET-UCL-ICH-20-03-2016-15:23:54:628-567 - samples

Project description:Immunoglobulin heavy chain gene high throughput sequencing of paediatric acute lymphoblastic leukaemia samples, for the purpose of MRD on the Illumina MiSeq platform. This dataset contains summary fastq files and raw bcl files from the MiSeq for this study. In the study we identify errors associated with multiplexing that could potentially impact on the accuracy of MRD analysis. We optimise a strategy combining high purity, sequence-optimised oligonucleotides, dual-indexing and an error-aware demultiplexing approach to minimise errors and maximise sensitivity.

| EGAD00001001983 | EGA

Microbial community structure of a lotic aquatic system receiving wastewater effluent

Project description:Total bacterial DNA was isolated from water and sediment samples from a local watershed and 16S rRNA sequences were analyzed using the Illumina MiSeq v3 platform in order to generate snapshots of bacterial community profiles. A total of 56 samples were collected that represent water and sediment samples from 14 sample sites over two different time points (November 18 and 25, 2011).

2016-07-03 | E-GEOD-73842 | biostudies-arrayexpress

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data