Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Synthetic metagenome

ABSTRACT: Mock community 16S rRNA V4 sequence

PROVIDER: PRJNA217969 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR966823_1.fastq.gz	Fastqsanger.gz
	SRR966823_2.fastq.gz	Fastqsanger.gz
	SRR966824_1.fastq.gz	Fastqsanger.gz
	SRR966824_2.fastq.gz	Fastqsanger.gz
	SRR966825_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 18

Similar Datasets

The human Gut Chip M-bM-^@M-^\HuGChipM-bM-^@M-^], an explorative phylogenetic microarray for determining gut microbiome diversity at Family level

Project description:A phylogenetic microarray targeting 66 families described in the human gut microbiota has been developped aud used to monitor the gut microbiota's structure and diversity. The microarray format provided by Agilent and used in this study is 8x15K. A study with a total of 4 chips was realized. Arrays 1 and 2: Hybridization with 100ng of labelled 16S rRNA gene amplicons from a mock community sample and 250ng of labelled 16S rRNA gene amplicons from 1 faecal sample. Each Agilent-030618 array probe (4441) was synthetized in three replicates. Arrays 3 and 4: Hybridization with 250ng of labelled 16S rRNA gene amplicons from 2 faecal samples. Each Agilent-40558 array probe (4441) was synthetized in three replicates.

2013-03-01 | E-GEOD-44752 | biostudies-arrayexpress

Quantification of mock microbial communities with metagenomes, 16S rRNA gene amplicons and metaproteomics

Project description:In this study we developed metaproteomics based methods for quantifying taxonomic composition of microbiomes (microbial communities). We also compared metaproteomics based quantification to other quantification methods, namely metagenomics and 16S rRNA gene amplicon sequencing. The metagenomic and 16S rRNA data can be found in the European Nucleotide Archive (Study number: PRJEB19901). For the method development and comparison of the methods we analyzed three types of mock communities with all three methods. The communities contain between 28 to 32 species and strains of bacteria, archaea, eukaryotes and bacteriophage. For each community type 4 biological replicate communities were generated. All four replicates were analyzed by 16S rRNA sequencing and metaproteomics. Three replicates of each community type were analyzed with metagenomics. The "C" type communities have same cell/phage particle number for all community members (C1 to C4). The "P" type communities have the same protein content for all community members (P1 to P4). The "U" (UNEVEN) type communities cover a large range of protein amounts and cell numbers (U1 to U4). We also generated proteomic data for four pure cultures to test the specificity of the protein inference method. This data is also included in this submission.

2017-05-12 | PXD006118 | Pride

synthetic metagenome

Project description:21 mock community

| PRJNA611685 | ENA

synthetic metagenome

Project description:An optimization of 16S community amplicon analysis using mock communities

| PRJNA348617 | ENA

Targeting the treponemal microbiome of digital dermatitis infections by deep coverage pyrosequencing

Project description:We examined 36 biopsies taken from digital dermatitis lesions of Holstein cows. The target was the V3 -V4 variable region of 16S rRNA using Treponema specific primers. We identified 20 different taxa of Treponema using this approach.

2013-06-25 | GSE42426 | GEO

synthetic metagenome

Project description:DsrAB Mock community Variation

| PRJNA292063 | ENA

Microbiota of Breast cancer in Algerian females

Project description:v3-v4 16S rRNA sequencing was used to characterize the differences in microbiota between specimens of breast cancer and healthy surrounding tissue in adult Algerian females

2025-07-30 | GSE243440 | GEO

Evaluating the gut microbiota shifts caused by two diets based on ancient grains

Project description:Total DNA was extracted from stool specimens, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2022-08-24 | GSE206807 | GEO

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

852d5472-a05f-4ee7-b957-394cf1a1a078 - samples

Project description:Metadata for fecal 16S-V4 rRNA gene sequence data from NCT02749630 healthy volunteers.

| EGAD00001008821 | EGA