Genome-wide binding of the CRISPR endonuclease Cas9 in mammalian cells
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA237533 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR1163500.fastq.gz | Fastqsanger.gz | |||
| SRR1168390.fastq.gz | Fastqsanger.gz | |||
| SRR1163501.fastq.gz | Fastqsanger.gz | |||
| SRR1168391.fastq.gz | Fastqsanger.gz | |||
| SRR1168382.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 18 |
Similar Datasets
Project description:The bacterial CRISPR-Cas9 system has been widely adapted for RNA-guided genome editing and gene regulation in diverse organisms yet its in vivo target specificity is poorly understood. Here we provide the first genome-wide binding maps of nuclease-deactivated Cas9 loaded with guide RNAs in mammalian cells. We find a 5-nucleotide seed region in the guide RNA targets Cas9 to thousands of sites in the genome. Chromatin accessibility limits binding to the other hundreds of thousands sites with matching seed sequences, and consequently 70% of off-target binding sites are associated with genes. U-rich seeds have low numbers of off-target sites limited by both low guide RNA abundance and scarcity of complimentary sites in accessible chromatin. Unexpectedly, off-target sites show little evidence of cleavage, supporting a two-state model reminiscent of eukaryotic RNAi machinery where a short seed match triggers binding but extensive pairing is required for cleavage. ChIP-seq of HA-dCas9 loaded with 4 sgRNAs (Phc1-sg1, Phc1-sg2, Nanog-sg2, and Nanog-sg3) in mouse, and 2 sgRNAs in human (EMX1-sg1 and EMX1-sg3)
2014-04-20 | E-GEOD-54745 | biostudies-arrayexpress
Project description:The bacterial CRISPR-Cas9 system has been widely adapted for RNA-guided genome editing and gene regulation in diverse organisms yet its in vivo target specificity is poorly understood. Here we provide the first genome-wide binding maps of nuclease-deactivated Cas9 loaded with guide RNAs in mammalian cells. We find a 5-nucleotide seed region in the guide RNA targets Cas9 to thousands of sites in the genome. Chromatin accessibility limits binding to the other hundreds of thousands sites with matching seed sequences, and consequently 70% of off-target binding sites are associated with genes. U-rich seeds have low numbers of off-target sites limited by both low guide RNA abundance and scarcity of complimentary sites in accessible chromatin. Unexpectedly, off-target sites show little evidence of cleavage, supporting a two-state model reminiscent of eukaryotic RNAi machinery where a short seed match triggers binding but extensive pairing is required for cleavage.
2014-04-20 | GSE54745 | GEO
Project description:The clustered regularly interspaced short palindromic repeat (CRISPR)-associated enzyme Cas9 is an RNA-guided nuclease that has been widely adapted for genome editing in eukaryotic cells. However, the in vivo target specificity of Cas9 is poorly understood and most studies rely on in silico predictions to define the potential off-target editing spectrum. Using chromatin immunoprecipitation followed by sequencing (ChIP-seq), we delineate the genome-wide binding panorama of catalytically inactive Cas9 directed by two different single guide (sg) RNAs targeting the Trp53 locus. Cas9:sgRNA complexes are able to load onto multiple sites with short seed regions adjacent to 5’NGG3’ protospacer adjacent motifs (PAM). Examination of dmCas9 binding sites using two Trp53 targeting sgRNAs in Arf -/- MEF cell line (mouse).
2014-08-29 | E-GEOD-57650 | biostudies-arrayexpress
Project description:The clustered regularly interspaced short palindromic repeat (CRISPR)-associated enzyme Cas9 is an RNA-guided nuclease that has been widely adapted for genome editing in eukaryotic cells. However, the in vivo target specificity of Cas9 is poorly understood and most studies rely on in silico predictions to define the potential off-target editing spectrum. Using chromatin immunoprecipitation followed by sequencing (ChIP-seq), we delineate the genome-wide binding panorama of catalytically inactive Cas9 directed by two different single guide (sg) RNAs targeting the Trp53 locus. Cas9:sgRNA complexes are able to load onto multiple sites with short seed regions adjacent to 5’NGG3’ protospacer adjacent motifs (PAM).
2014-08-29 | GSE57650 | GEO
Project description:By a robust unbiased ChIP-seq approach, we demonstrated that CRISPR/Cas9 had crRNA-specific off-target binding activities in human genome. However, most of those binding off-targets could not be efficiently cleaved both in vivo and in vitro which suggested the cleavage off-target activity of CRISPR/Cas9 in human genome is very limited. We provided a valuable tool to further investigate the molecular mechanism of CRISPR/Cas9 and to optimize its in vivo targeting sgRNA binding sites were identified with ChipSeq by using GFP antibody (there are 2 replicates for egfa-t1 sgRNA,emx1 sgRNA and control without sgRNA in Hek293T cells, one egfa-t1 sgRNA,emx1 sgRNA and control without sgRNA in HeLaS3 cells)
2014-06-18 | E-GEOD-58511 | biostudies-arrayexpress
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:Human acute myeloid leukemia cell lines OCI-AML2 and OCI-AML3 were used in a CRISPR/Cas9-mediated approach to specifically target DDX3X’s gene sequences encoding the RNA binding domain of the helicase. DDX3X RNA binding domain is bipartite in the two halves of the helicase core. sgRNAs were designed to target both halves of the domain (named RNA binding domain A and B – RBDA and RBDB). We performed RNA-seq to observe the gene expression changes in both OCI-AML2 and OCI-AML3 cell lines following the not-combined CRISPR/Cas9 –mediated targeting of both regions of the DDX3X RNA binding domain. Control CRISPR/Cas9 performed with no sgRNA expressing vector (named “empty vector”) was performed in both cell lines. The latter condition was used as a control for gene expression changes analysis, for each cell line.
2019-11-23 | E-MTAB-6241 | biostudies-arrayexpress
Project description:Bacterial type II CRISPR-Cas9 systems have been widely adapted for RNA-guided genome editing and transcription regulation in eukaryotic cells, yet their in vivo target specificity is poorly understood. Here we mapped genome-wide binding sites of a catalytically inactive Cas9 (dCas9) from Streptococcus pyogenes loaded with single guide RNAs (sgRNAs) in mouse embryonic stem cells (mESCs). Each of the four sgRNAs we tested targets dCas9 to between tens and thousands of genomic sites, frequently characterized by a 5-nucleotide seed region in the sgRNA and an NGG protospacer adjacent motif (PAM). Chromatin inaccessibility decreases dCas9 binding to other sites with matching seed sequences; thus 70% of off-target sites are associated with genes. Targeted sequencing of 295 dCas9 binding sites in mESCs transfected with catalytically active Cas9 identified only one site mutated above background levels. We propose a two-state model for Cas9 binding and cleavage, in which a seed match triggers binding but extensive pairing with target DNA is required for cleavage.
| S-EPMC4145672 | biostudies-literature
Project description:Genome-wide CRISPR-Cas9 knockout screen using TKOv1 sgRNA library was performed in isogenic RBM10-proficient and RBM10-deficient HCC827 cells.
2023-03-04 | E-MTAB-12724 | biostudies-arrayexpress
Project description:RNA-guided genome editing with the CRISPR-Cas9 system has great potential for basic and clinical research, but the determinants of targeting specificity and the extent of off-target cleavage remain insufficiently understood. Using chromatin immunoprecipitation and high-throughput sequencing (ChIP-seq), we mapped genome-wide binding sites of catalytically inactive Cas9 (dCas9) in HEK293T cells, in combination with 12 different single guide RNAs (sgRNAs). The number of off-target sites bound by dCas9 varied from ~10 to >1,000 depending on the sgRNA. Analysis of off-target binding sites showed the importance of the PAM-proximal region of the sgRNA guiding sequence and that dCas9 binding sites are enriched in open chromatin regions. When targeted with catalytically active Cas9, some off-target binding sites had indels above background levels in a region around the ChIP-seq peak, but generally at lower rates than the on-target sites. Our results elucidate major determinants of Cas9 targeting, and we show that ChIP-seq allows unbiased detection of Cas9 binding sites genome-wide 1.sgRNA1-6 binding sites were identified with ChipSeq by using HA antibody (there are 2 replicates for sgRNA1-3, one sample for sgRNA4-6,one control without sgRNA) 2.PCR products which amplifies " off-target genomic sites" were deep sequenced in the presence of WT Cas9+sgRNA or WT Cas9 alone( unique adaptor was used for each sgRNA and mixed for multiplex run)
2014-05-18 | E-GEOD-55887 | biostudies-arrayexpress