Homo sapiens
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA289388 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR2096240_1.fastq.gz | Fastqsanger.gz | |||
| SRR2096240_2.fastq.gz | Fastqsanger.gz | |||
| SRR2096250_1.fastq.gz | Fastqsanger.gz | |||
| SRR2096250_2.fastq.gz | Fastqsanger.gz | |||
| SRR2096241_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 48 |
Similar Datasets
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:The CRISPR/Cas9 system shows diverse levels of genome editing activities on eukaryotic genomic DNA targets, and experiments desire high-efficiency targets. Here we show that chromatin open status is a pivotal determinant of the Cas9 editing activity in mammalian cells, and increasing chromatin accessibility can efficiently improve Cas9 genome editing activity. However, the strategy that fusing the VP64 transcriptional activation domain at the C-terminus of Cas9 can only promote genome editing activity slightly at most tested CRISPR/Cas9 targets in Lenti-X 293T cells. Because histone acetylation increases eukaryotic chromatin accessibility, we further improve genome editing by elevating histone acetylation. We demonstrate that promoting histone acetylation using histone acetyltransferase (HAT) activator YF-2 can improve genome editing from Cas9 and more robustly from the Cas9 transcriptional activator. This provides a strategy to improve CRISPR/Cas9 genome editing activity and enables broader gRNA target choices in eukaryotes.
2022-04-21 | GSE200943 | GEO
Project description:The parallel disruption of multiple genes coupled with targeted transgene insertion offers a powerful strategy for more effective and precise cell engineering. However, such orthogonal editing involves the induction of multiple DNA breaks, raising safety concerns related to the risks of chromosomal translocations. Here, we present a polyfunctional CRISPR-Cas9-based strategy that enables both transgene insertion and epigenetic silencing at distinct genomic loci in a single treatment without inducing reciprocal chromosomal translocations. This is accomplished through an optimized all-in-one epigenome editor equipped with a catalytically active Cas9, whose endonuclease activity is selectively disabled at epigenetically silenced loci by the use truncated gRNAs. As a proof of concept, we demonstrated that this platform enables efficient multi-locus editing, including functional replacement of the endogenous TCR with a tumor-selective one, targeted insertion of a prototypic CAR with either a selectable marker or an immunomodulatory receptor into a TCR locus or a ubiquitously expressed gene, and durable, multiplexed epigenetic silencing of clinically relevant genes in primary human T cells. Polyfunctional editing establishes a versatile and safe framework for orthogonal editing, broadening the scope of genome and epigenome engineering in cancer immunotherapy and beyond.
2026-04-06 | GSE293142 | GEO
Project description:The parallel disruption of multiple genes coupled with targeted transgene insertion offers a powerful strategy for more effective and precise cell engineering. However, such orthogonal editing involves the induction of multiple DNA breaks, raising safety concerns related to the risks of chromosomal translocations. Here, we present a polyfunctional CRISPR-Cas9-based strategy that enables both transgene insertion and epigenetic silencing at distinct genomic loci in a single treatment without inducing reciprocal chromosomal translocations. This is accomplished through an optimized all-in-one epigenome editor equipped with a catalytically active Cas9, whose endonuclease activity is selectively disabled at epigenetically silenced loci by the use truncated gRNAs. As a proof of concept, we demonstrated that this platform enables efficient multi-locus editing, including functional replacement of the endogenous TCR with a tumor-selective one, targeted insertion of a prototypic CAR with either a selectable marker or an immunomodulatory receptor into a TCR locus or a ubiquitously expressed gene, and durable, multiplexed epigenetic silencing of clinically relevant genes in primary human T cells. Polyfunctional editing establishes a versatile and safe framework for orthogonal editing, broadening the scope of genome and epigenome engineering in cancer immunotherapy and beyond.
2026-04-06 | GSE319119 | GEO
Project description:The parallel disruption of multiple genes coupled with targeted transgene insertion offers a powerful strategy for more effective and precise cell engineering. However, such orthogonal editing involves the induction of multiple DNA breaks, raising safety concerns related to the risks of chromosomal translocations. Here, we present a polyfunctional CRISPR-Cas9-based strategy that enables both transgene insertion and epigenetic silencing at distinct genomic loci in a single treatment without inducing reciprocal chromosomal translocations. This is accomplished through an optimized all-in-one epigenome editor equipped with a catalytically active Cas9, whose endonuclease activity is selectively disabled at epigenetically silenced loci by the use truncated gRNAs. As a proof of concept, we demonstrated that this platform enables efficient multi-locus editing, including functional replacement of the endogenous TCR with a tumor-selective one, targeted insertion of a prototypic CAR with either a selectable marker or an immunomodulatory receptor into a TCR locus or a ubiquitously expressed gene, and durable, multiplexed epigenetic silencing of clinically relevant genes in primary human T cells. Polyfunctional editing establishes a versatile and safe framework for orthogonal editing, broadening the scope of genome and epigenome engineering in cancer immunotherapy and beyond.
2026-04-06 | GSE319118 | GEO
Project description:The parallel disruption of multiple genes coupled with targeted transgene insertion offers a powerful strategy for more effective and precise cell engineering. However, such orthogonal editing involves the induction of multiple DNA breaks, raising safety concerns related to the risks of chromosomal translocations. Here, we present a polyfunctional CRISPR-Cas9-based strategy that enables both transgene insertion and epigenetic silencing at distinct genomic loci in a single treatment without inducing reciprocal chromosomal translocations. This is accomplished through an optimized all-in-one epigenome editor equipped with a catalytically active Cas9, whose endonuclease activity is selectively disabled at epigenetically silenced loci by the use truncated gRNAs. As a proof of concept, we demonstrated that this platform enables efficient multi-locus editing, including functional replacement of the endogenous TCR with a tumor-selective one, targeted insertion of a prototypic CAR with either a selectable marker or an immunomodulatory receptor into a TCR locus or a ubiquitously expressed gene, and durable, multiplexed epigenetic silencing of clinically relevant genes in primary human T cells. Polyfunctional editing establishes a versatile and safe framework for orthogonal editing, broadening the scope of genome and epigenome engineering in cancer immunotherapy and beyond.
2026-04-06 | GSE293141 | GEO
Project description:The parallel disruption of multiple genes coupled with targeted transgene insertion offers a powerful strategy for more effective and precise cell engineering. However, such orthogonal editing involves the induction of multiple DNA breaks, raising safety concerns related to the risks of chromosomal translocations. Here, we present a polyfunctional CRISPR-Cas9-based strategy that enables both transgene insertion and epigenetic silencing at distinct genomic loci in a single treatment without inducing reciprocal chromosomal translocations. This is accomplished through an optimized all-in-one epigenome editor equipped with a catalytically active Cas9, whose endonuclease activity is selectively disabled at epigenetically silenced loci by the use truncated gRNAs. As a proof of concept, we demonstrated that this platform enables efficient multi-locus editing, including functional replacement of the endogenous TCR with a selectable retargeting cassette, targeting a prototypic CAR and an immunomodulatory receptor into a ubiquitously expressed gene, and durable, multiplexed epigenetic silencing of clinically relevant genes in primary human T cells. Polyfunctional editing establishes a versatile framework for orthogonal editing with an enhanced safety profile, broadening the scope of genome and epigenome engineering in cancer immunotherapy and beyond.
2026-04-07 | GSE318736 | GEO
Project description:The parallel disruption of multiple genes coupled with targeted transgene insertion offers a powerful strategy for more effective and precise cell engineering. However, such orthogonal editing involves the induction of multiple DNA breaks, raising safety concerns related to the risks of chromosomal translocations. Here, we present a polyfunctional CRISPR-Cas9-based strategy that enables both transgene insertion and epigenetic silencing at distinct genomic loci in a single treatment without inducing reciprocal chromosomal translocations. This is accomplished through an optimized all-in-one epigenome editor equipped with a catalytically active Cas9, whose endonuclease activity is selectively disabled at epigenetically silenced loci by the use truncated gRNAs. As a proof of concept, we demonstrated that this platform enables efficient multi-locus editing, including functional replacement of the endogenous TCR with a tumor-selective one, targeted insertion of a prototypic CAR with either a selectable marker or an immunomodulatory receptor into a TCR locus or a ubiquitously expressed gene, and durable, multiplexed epigenetic silencing of clinically relevant genes in primary human T cells. Polyfunctional editing establishes a versatile and safe framework for orthogonal editing, broadening the scope of genome and epigenome engineering in cancer immunotherapy and beyond.
2026-04-06 | GSE319117 | GEO
Project description:The parallel disruption of multiple genes coupled with targeted transgene insertion offers a powerful strategy for more effective and precise cell engineering. However, such orthogonal editing involves the induction of multiple DNA breaks, raising safety concerns related to the risks of chromosomal translocations. Here, we present a polyfunctional CRISPR-Cas9-based strategy that enables both transgene insertion and epigenetic silencing at distinct genomic loci in a single treatment without inducing reciprocal chromosomal translocations. This is accomplished through an optimized all-in-one epigenome editor equipped with a catalytically active Cas9, whose endonuclease activity is selectively disabled at epigenetically silenced loci by the use truncated gRNAs. As a proof of concept, we demonstrated that this platform enables efficient multi-locus editing, including functional replacement of the endogenous TCR with a tumor-selective one, targeted insertion of a prototypic CAR with either a selectable marker or an immunomodulatory receptor into a TCR locus or a ubiquitously expressed gene, and durable, multiplexed epigenetic silencing of clinically relevant genes in primary human T cells. Polyfunctional editing establishes a versatile and safe framework for orthogonal editing, broadening the scope of genome and epigenome engineering in cancer immunotherapy and beyond.
2026-04-06 | GSE319115 | GEO
Project description:CRISPR-Cas9 delivery by AAV holds promise for gene therapy but faces critical barriers due to its potential immunogenicity and limited payload capacity. Here, we demonstrate genome engineering in postnatal mice using AAV-split-Cas9, a multi-functional platform customizable for genome-editing, transcriptional regulation, and other previously impracticable AAV-CRISPR-Cas9 applications. We identify crucial parameters that impact efficacy and clinical translation of our platform, including viral biodistribution, editing efficiencies in various organs, antigenicity, immunological reactions, and physiological outcomes. These results reveal that AAV-CRISPR-Cas9 evokes host responses with distinct cellular and molecular signatures, but unlike alternative delivery methods, does not induce detectable cellular damage in vivo. Our study provides a foundation for developing effective genome therapeutics mRNA-Seq from muscles (9 samples; 3 mice x 3 conditions) and lymph nodes (9 samples; 3 mice x 3 conditions).
2016-07-29 | E-GEOD-84534 | biostudies-arrayexpress