Project description:Recently, cancer immunotherapy has been paid much attention because of its improved efficacy and low frequency of adverse effects. A mouse breast cancer cell line, 4T1, has been known as poorly immunogeneic and highly metastatic cell line. In this study, we have identified a sub cell line of 4T1, designated as 4T1-Sapporo (4T1-S), which could induce a strong immune response against the same line. When 4T1-S was subcutaneously injected, striking enlargement of draining lymph nodes and increase of activated T cells were observed. The strong immune responses could not be observed when 4T1-S was injected to nude mice, indicating that this phenomenon is mediated by T cell response. Identification of 4T1-S characteristics may help to improve immunotherapy against breast cancer. 4T1-A1, 4T1-A2, 4T1-S1, 4T1-S2
Project description:Recently, cancer immunotherapy has been paid much attention because of its improved efficacy and low frequency of adverse effects. A mouse breast cancer cell line, 4T1, has been known as poorly immunogeneic and highly metastatic cell line. In this study, we have identified a sub cell line of 4T1, designated as 4T1-Sapporo (4T1-S), which could induce a strong immune response against the same line. When 4T1-S was subcutaneously injected, striking enlargement of draining lymph nodes and increase of activated T cells were observed. The strong immune responses could not be observed when 4T1-S was injected to nude mice, indicating that this phenomenon is mediated by T cell response. Identification of 4T1-S characteristics may help to improve immunotherapy against breast cancer.
Project description:Breast cancer remains a significant global health challenge, with the highly aggressive 4T1 mouse mammary carcinoma cell line serving as a common model for studying triple-negative breast cancer (TNBC) due to its metastatic potential and resistance to therapy. Cepharanthine (CEP), a natural bisbenzylisoquinoline alkaloid, has demonstrated anti-inflammatory, immunomodulatory, and anti-cancer properties in various malignancies. However, its molecular mechanisms in 4T1 cells remain poorly understood. In this study, we treated 4T1 cells with CEP and performed RNA sequencing (RNA-seq) to elucidate transcriptomic alterations induced by this compound.
Project description:Triple-negative breast cancer (TNBC) patients exhibit variable responses to programmed death (PD)-ligand (L)1 blockade, largely determined by the ‘hot’ versus ‘cold’ state of the tumor immune microenvironment (TIME). We here characterized 9 mouse TNBC models, relying on intraductal mammary gland inoculation of established mouse TNBC cell lines, with a heterogeneous TIME to study anti-PD-L1 resistance mechanisms. Complementary in vitro and in vivo screening classified the 4T1-hot-based model, a highly inflamed control through its immunogenic luciferase tag expression compared to the untagged 4T1-cold-based model, as displaying the ‘hottest’ TIME. However, both 4T1-based counterparts did not respond to anti-PD-L1, which was attributed to their immunosuppressive myeloid cell content as well as upregulation of cancer-associated fibroblasts in the 4T1-hot and high PD-L1-expressing CXCL10+ tumor-associated macrophages in 4T1-cold primary tumors. These anti-PD-L1 adaptation mechanisms across TIME states as captured by mouse TNBC models highlight specific cellular targets for future studies.
Project description:Triple-negative breast cancer (TNBC) patients exhibit variable responses to programmed death (PD)-ligand (L)1 blockade, largely determined by the ‘hot’ versus ‘cold’ state of the tumor immune microenvironment (TIME). We here characterized 9 mouse TNBC models, relying on intraductal mammary gland inoculation of established mouse TNBC cell lines, with a heterogeneous TIME to study anti-PD-L1 resistance mechanisms. Complementary in vitro and in vivo screening classified the 4T1-hot-based model, a highly inflamed control through its immunogenic luciferase tag expression compared to the untagged 4T1-cold-based model, as displaying the ‘hottest’ TIME. However, both 4T1-based counterparts did not respond to anti-PD-L1, which was attributed to their immunosuppressive myeloid cell content as well as upregulation of cancer-associated fibroblasts in the 4T1-hot and high PD-L1-expressing CXCL10+ tumor-associated macrophages in 4T1-cold primary tumors. These anti-PD-L1 adaptation mechanisms across TIME states as captured by mouse TNBC models highlight specific cellular targets for future studies.
Project description:Triple-negative breast cancer (TNBC) patients exhibit variable responses to programmed death (PD)-ligand (L)1 blockade, largely determined by the ‘hot’ versus ‘cold’ state of the tumor immune microenvironment (TIME). We here characterized 9 mouse TNBC models, relying on intraductal mammary gland inoculation of established mouse TNBC cell lines, with a heterogeneous TIME to study anti-PD-L1 resistance mechanisms. Complementary in vitro and in vivo screening classified the 4T1-hot-based model, a highly inflamed control through its immunogenic luciferase tag expression compared to the untagged 4T1-cold-based model, as displaying the ‘hottest’ TIME. However, both 4T1-based counterparts did not respond to anti-PD-L1, which was attributed to their immunosuppressive myeloid cell content as well as upregulation of cancer-associated fibroblasts in the 4T1-hot and high PD-L1-expressing CXCL10+ tumor-associated macrophages in 4T1-cold primary tumors. These anti-PD-L1 adaptation mechanisms across TIME states as captured by mouse TNBC models highlight specific cellular targets for future studies.
Project description:Myosin 1e may influnece the metastatic spread of breast cancer cells as determined using the MMT-PyMT mouse model deficient in myo1e, which demonstrated no lung metastases. Therefore, we used CRISPR to knock out Myosin 1e (myo1e) in the 4T1 breast cancer line to study the effect on the propensity to metastasize. The Myosin 1e (Myo1e) WT and KO 4T1 cell pools were generated by Synthego using gRNA sequence 'CUUCUUCAGGUUCUCUACAA'.
Project description:RNA Sequencing of the murine breast cancer cell line 4T1 and of the murine melanoma cell line B16-ova was carried out with the aim of establishing the complete transcriptome of these cell lines. Because these are cancer cells and we expect a lot of aberrant splicing, we carried out de novo assembly (genome guided) of the transcripts. We also ran deep Mass Spectrometry proteomics analysis on the same cell lines, aiming to determine which aberrant transcripts carry over to the protein expression level. Further, we tested these cancer specific protein epitopes (putative neoantigens) for immunogenicity using mouse models. Finally, the putative neoantigens that showed good immunogenic potential were used in tumor growth control experiments with mice engrafted with the two tumor cell lines. In these experiments we tested whether cancer vaccines based on individual neoantigen peptides (MHC-I) restricted the growth of the tumor compared to adequate controls. The overall aim of the project is to validate the ability of our multi-omics/bioinformatics pipeline to identify and deliver neoantigens that can be used to suppress tumor growth.
Project description:Microaaray data for CD44v8-10-positive / CD44v8-10-negative 4T1 cancer cells (mouse breast cancer cells) We used microarrays to detail the global programming of gene expression of 4T1 cells depending on whether CD44v is present or not. 4T1 cells, one of the mouse breast cancer cells, were selected for RNA extraction and hybridization on Affymetrix microarrays. We sought to obtain the data about to which extent gene expression profile is different between CD44v-positive and CD44v-negative 4T1 cancer cells.