Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: South China Sea interfaces 16S amplicon sequencing

PROVIDER: PRJNA362622 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR5190060_1.fastq.gz	Fastqsanger.gz
	SRR5190060_2.fastq.gz	Fastqsanger.gz
	SRR5190070_1.fastq.gz	Fastqsanger.gz
	SRR5190070_2.fastq.gz	Fastqsanger.gz
	SRR5190080_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 120

Similar Datasets

Project description:South China Sea sediment microbial 16S rRNA gene amplicon sequencing

| PRJNA606622 | ENA

Project description:South China Sea Cold Seep 16S & ITS Target Amplicon Sequencing

| PRJNA836361 | ENA

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Lipidome data of environmental samples

Project description:This study examined archaeal lipidome of a total of 52 sediment and soil samples across a wide range of environmental gradients, including sediment from hot springs in Tengchong, Yunan Province, sediment from acid mine drainages in Anhui and Guangdong provinces, permafrost soil from Tibet Plateau, soil from Western Sichuan Plateau, surface sediment of cold seeps and sediment core material from the South China Sea, and sediment from the East China Sea.

2025-02-14 | MSV000097126 | MassIVE

Illuminating the metabolic activities of deep-sea microbes and their functional adaptation to the harsh nutritional conditions with metaproteomics

Project description:In the present study, we studied microbial composition and metabolic activity in the bathypelagic zone of the South China Sea. 12 samples were collected and subjected to metaproteomic analysis. Our data provide a novel view of the roles of two lifestyle prokaryotes and their link in substrate utilization in dark ocean.

2024-06-16 | PXD026838 | Pride

South China Sea

Project description:South China Sea Genome sequencing

| PRJNA1057713 | ENA

Metaproteomic analysis of microbial community structure and function in the South China Sea

Project description:In the present study, we studied microbial composition and metabolic activity in the euphotic zone of the South China Sea. 8 samples were collected and subjected to metaproteomic analysis. Our results suggested that mixotrophic phototrophs-driven NDL carbon fixation along with phytoplankton-driven NRL carbon fixation determined primary production in the oligotrophic ocean’s euphotic zone.

2024-06-16 | PXD018513 | Pride

Experimental tests strongly challenge the evidence of a healthy human blood microbiome

Project description:The study critically evaluate the results of 16S targeted amplicon sequencing performed on the total DNA collected from healthy donors’ blood samples in the light of specific negative controls.

2024-03-01 | GSE254843 | GEO

Neorhizobium sp. CSC1952 strain:south China sea | isolate:south China sea

Project description:Neorhizobium sp. CSC1952 strain:south China sea | isolate:south China sea Genome sequencing

| PRJNA984414 | ENA

Neorhizobium sp. CSC1952 strain:South China Sea | isolate:South China Sea

Project description:Neorhizobium sp. CSC1952 strain:South China Sea | isolate:South China Sea Genome sequencing

| PRJNA1031374 | ENA