Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Sequential enhancer sequestration dysregulates recombination center formation at the IgH locus

ABSTRACT: Sequential enhancer sequestration dysregulates recombination center formation at the IgH locus

PROVIDER: PRJNA431555 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR6511362.fastq.gz	Fastqsanger.gz
	SRR6511363.fastq.gz	Fastqsanger.gz
	SRR6511364.fastq.gz	Fastqsanger.gz
	SRR6511365.fastq.gz	Fastqsanger.gz
	SRR6511366.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 8

Similar Datasets

Sequential enhancer sequestration dysregulates recombination center formation at the IgH locus

Project description:Sequential enhancer sequestration dysregulates recombination center formation at the IgH locus

| PRJNA432738 | ENA

Sequential enhancer sequestration dysregulates recombination center formation at the IgH locus

Project description:We report that Sequential deletion of CTCF binding elements leads to sequential proximal VH utilization.

2018-02-21 | GSE110090 | GEO

Sequential Enhancer Sequestration Dysregulates Recombination Center Formation at the IgH Locus.

Project description:Immunoglobulin heavy-chain (IgH) genes are assembled by DNA rearrangements that juxtapose a variable (VH), a diversity (DH), and a joining (JH) gene segment. Here, we report that in the absence of intergenic control region 1 (IGCR1), the intronic enhancer (Eμ) associates with the next available CTCF binding site located close to VH81X via putative heterotypic interactions involving YY1 and CTCF. The alternate Eμ/VH81X loop leads to formation of a distorted recombination center and altered DH rearrangements and disrupts chromosome conformation that favors distal VH recombination. Cumulatively, these features drive highly skewed, Eμ-dependent recombination of VH81X. Sequential deletion of CTCF binding regions on IGCR1-deleted alleles suggests that they influence recombination of single proximal VH gene segments. Our observations demonstrate that Eμ interacts differently with IGCR1- or VH-associated CTCF binding sites and thereby identify distinct roles for insulator-like elements in directing enhancer activity.

| S-EPMC6003238 | biostudies-literature

Sequential enhancer sequestration dysregulates recombination center formation at the IgH locus

Project description:We reoprt that transcriptional level of distal VH is dependent of both intronic enhancer (Eµ) and intergenic control region 1 (IGCR1).

2018-02-07 | GSE109631 | GEO

The Chromatin Reader ZMYND8 Regulates Igh Enhancers to Promote Immunoglobulin Class Switch Recombination

Project description:Class Switch Recombination (CSR) is a DNA recombination reaction that diversifies the effector component of antibody responses. CSR is initiated by activation-induced cytidine deaminase (AID), which targets transcriptionally active immunoglobulin heavy chain (Igh) switch donor and acceptor DNA. The 3’ Igh super-enhancer, 3’ Regulatory Region (3’RR), is essential for acceptor region transcription, but how this function is regulated is unknown. Here we identify the chromatin reader ZMYND8 as an essential regulator of the 3’RR and CSR. In B cells, ZMYND8 binds promoters and super-enhancers, including the 3’RR, and controls its activity by modulating the enhancer transcriptional status. In its absence, there is increased 3’RR polymerase loading, and decreased acceptor region transcription and CSR. In addition to CSR, ZMYND8 deficiency impairs somatic hypermutation (SHM) of Igh, which is also dependent on the 3’RR. Thus ZMYND8 controls Igh diversification in mature B lymphocytes by regulating the activity of the 3’ Igh super-enhancer.

2018-10-04 | GSE118794 | GEO

Altered 3D chromatin structure permits inversional recombination at the IgH locus

Project description:We report that in the absence of intergenic control region 1 (IGCR1), a regulatory sequence that specifies the RAG scanning domain on WT IgH alleles, VH and DH gene segments can recombine with each other by both deletion and inversion of intervening DNA.

2020-06-18 | GSE133185 | GEO

Altered 3D chromatin structure permits inversional recombination at the IgH locus

2020-07-02 | GSE135763 | GEO

Med1 facilitates transcriptional activation and dynamic long-range contacts at the IgH locus during class switch recombination.

Project description:Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to immunoglobulin switch (S) regions. During CSR, the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and S regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we conditionally inactivated in B cells the Med1 subunit of mediator, a complex implicated in transcription initiation and long-range enhancer/promoter loop formation. We find that Med1-deficiency results in defective CSR, reduced acceptor switch region transcription and that this correlates with reduced long-range interactions between the acceptor switch regions and the Em enhancer, as determined by 4C-Seq. Our results implicate the mediator complex in the mechanism of CSR and are consistent with a model in which Med1 facilitates the transcriptional activation of switch regions and their long-range contacts with the IgH locus enhancers during CSR. 4C-seq data in resting and activated WT and Med1 mutant B cells. 4C bait was designed in the Eu enhancer of the Igh locus on chromosome 12. Primer sequences: 5â TCTGTCCTAAAGGCTCTGAGA 3â and 5â GAACACAGAAGTATGTGTATGGA 3â.

2016-02-17 | E-GEOD-62969 | biostudies-arrayexpress

Wapl repression by Pax5 promotes loop extrusion and V gene recombination at the Igh locus

Project description:The generation of a diverse antibody repertoire is essential for humoral immunity and requires the participation of all V genes in V(D)J recombination, which depends on the Pax5-regulated contraction of the 2.8-Mb long immunoglobulin heavy-chain (Igh) locus. How Pax5 controls Igh contraction in pro-B cells is, however, not known. Here, we demonstrate that locus contraction is caused by cohesin-mediated chromatin loop extrusion across the entire Igh locus. Notably, expression of the cohesin-release factor Wapl is repressed by Pax5 specifically in pro-B and pre-B cells, which facilitates extended loop extrusion by increasing the residence time of cohesin on chromatin. Pax5 mediates the transcriptional repression of Wapl through a single Pax5-binding site by recruiting the Polycomb repressive complex 2 to induce bivalent chromatin at the Wapl promoter. Reduced Wapl expression causes global alterations of the three-dimensional chromatin architecture, indicating that the potential to recombine all V genes entails structural changes of the entire genome in pro-B cells.

2020-07-01 | GSE140975 | GEO

Altered 3D chromatin structure permits inversional recombination at the IgH locus (Capture Hi-C)

Project description:We reoprt that in the absence of intergenic control region 1 (IGCR1), a regulatory sequence that specifies the RAG scanning domain on WT IgH alleles, VH and DH gene segments can recombine with each other by both deletion and inversion of intervening DNA.

2020-07-01 | GSE145472 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data