Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: 16S rDNA of microbiota in feces. Raw sequence reads

PROVIDER: PRJNA550022 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR9334020_1.fastq.gz	Fastqsanger.gz
	SRR9334020_2.fastq.gz	Fastqsanger.gz
	SRR9334030_1.fastq.gz	Fastqsanger.gz
	SRR9334030_2.fastq.gz	Fastqsanger.gz
	SRR9334040_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 421

Similar Datasets

16s rRNA-young and old mouse gut microbiota-stroke

Project description:To explore the effects of gut microbiota of young (8 weeks) or old mice (18～20 months) on stroke, feces of young (Y1-Y9) and old mice (O6-O16) were collected and analyzed by 16s rRNA sequencing. Then stroke model was established on young mouse receive feces from old mouse (DOT1-15) and young mouse receive feces from young mouse (DYT1-15). 16s rRNA sequencing were also performed for those young mice received feces from young and old mice.

2021-10-15 | E-MTAB-10837 | biostudies-arrayexpress

High-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.

2022-04-02 | GSE199749 | GEO

Feces 16S rRNA seq of mice treated by AZ1 with 2.5% DSS or H2O

Project description:Feces 16s rRNA seq experiments is required to demonstrate the AZ1 doesn’t impact the intestinal microbiota.

2020-02-14 | GSE143003 | GEO

Correlation analysis between gut microbiota characteristics and melasma

Project description:To compare the similarities and differences in species diversity of the gut microbiota between the patients with melasma and healthy subjects. The feces were collected for 16S rRNA sequencing analysis of the gut microbiota.

2022-10-25 | GSE214430 | GEO

Impact of fecal microbiota transplantation (FMT) in 3 days-ABX-treated recipient mice using feces from 6 NSCLC patients at diagnosis.

Project description:This study aimed to analyze changes in gut microbiota composition in mice after transplantation of fecal microbiota (FMT, N = 6) from the feces of NSCLC patients by analyzing fecal content using 16S rRNA sequencing, 10 days after transplantation. Specific-pathogen-free (SPF) mice were used for each experiments (N=4) as controls.

2023-07-01 | E-MTAB-12812 | biostudies-arrayexpress

16S rRNA gene sequence analysis of feces samples from rats treated with paclitaxel or vehicle controls

Project description:To address the role of gut microbiota in the development of paclitaxel-induced peripheral neuropathy (PIPN), we performed 16S rRNA sequencing analysis of feces samples at 14 days and 28 days after the initiation of paclitaxel or vehicle injections.

2023-10-16 | E-MTAB-13426 | biostudies-arrayexpress

Fecal microbiota in mice before and after repeated mild stress

Project description:To examine potential changes of the intestinal microbiota in mice caused by repeated mild stress, we profiled bacteria and fungi in the mouse feces by sequencing the 16s v3v4 region and the ITS1-2 region.

2024-09-23 | GSE222533 | GEO

ZFP90 drives initiation of colitis-associated colorectal cancer using a microbiota-dependent strategy

Project description:Chronic inflammation and gut microbiota dysbiosis are risk factors for colorectal cancer. In clinical practice, inflammatory bowel disease (IBD) patients have a greatly increased risk of developing colitis associated colorectal cancer (CAC). However, the basis underlying the initiation of CAC remains to be explored. Systematic filtration through existing genome-wide association study (GWAS) and conditional deletion of Zfp90 in CAC mice model indicated that Zfp90 was a putative oncogene in CAC development. Strikingly, depletion of gut microbiota eliminated the tumorigenic effect of Zfp90 in CAC mice model. Moreover, fecal microbiota transplantation demonstrated Zfp90 promoted CAC depending on gut microbiota. Combining 16s rDNA sequencing in feces specimens from CAC mice model, we speculated that Prevotella copri-defined microbiota might mediate the oncogenic role of Zfp90 in the development of CAC. Mechanistic studies revealed Zfp90 accelerated CAC development through Tlr4-Pi3k-Akt-Nf-κb pathway. Our findings elucidated the crucial role of Zfp90-microbiota-Nf-κb axis in creating a tumor-promoting environment and suggested therapeutic targets for CAC prevention and treatment.

2022-08-14 | GSE156241 | GEO

Mus musculus feces 16s rDNA sequencing

Project description:Mus musculus feces 16s rDNA sequencing Raw sequence reads

| PRJNA874477 | ENA

Gut microbiota analysis in WT and Il17d-deficient mice treated with or without colitis

Project description:Microbiota dysbiosis has been reported to contribute to the pathogenesis of colitis, to demonstrate whether IL-17D protects against DSS-induced colitis through regulation of microflora, we performed 16S rRNA sequencing in feces from WT and Il17d-deficient mice. Our data indicate that Il17d deficiency results in microbiota dysibiosis in both steady state and DSS-induced colitis.

2021-05-20 | GSE165789 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data