Project description:To discover the core gene expression features of CtBP1, CtBP2 differently regulated in ovarian cancer SKOV3 cells. The compared the whole transcript expression profiling between CtBP1 knockdown, CtBP2 knockdown and scramble control in ovarian cancer skov3 cells.
Project description:we performed RNA-seq on the total RNA samples collected from the scramble and Hif-1a knockdown AB2.2 mESCs cultured under normoxia and two-day hypoxia, respectively. Sramble and Hif-1a knockdown AB2.2 mESCs were built by infecting AB2.2 cells with lentiviruses. Each group contained three biological replicates. The expression matrix was obtained by Hisat2 followed by Stringtie.
Project description:CCAT1-L is a highly expressed long noncoding RNA located in the colorectal cancer specific super enhance region about 500 kb upstream of MYC gene. Knockdown of CCAT1-L significantly down-regulated interaction frequency between CCAT1 and MYC locus and repress MYC expression, suggesting a long-range chromatin interaction between CCAT1-L and MYC locus maintained by CCAT1-L underlie the MYC regulation. To further validate this hypothesis, multiplexed 3C sequencing (3C-seq) was employed to evaluate chromatin interaction strength between CCAT1-L and MYC locus in CCAT1-L knockdown and scramble knockdown (Scr) HT29 cells. The 3C-Seq design and data analysis were performed according to Stadhouders et al, Nat Protoc. 2013, 8:509-524. A series of bait sequences accommodating different locus around CCAT1-L and MYC were selected. Through integrating with specific sample barcodes, bait-specific primer sets were designed to construct relevant 3C-seq libraries in CCAT1-L knockdown and scramble knockdown (Scr) HT29 samples. All of the 3C sample libraries from different treatment, including CCAT1-L knockdown and scramble knockdown (Scr), were then pooled together for high-throughput sequencing. Two technical 3C-seq were performed (CCAT1_myc_3C_1.txt.gz and CCAT1_myc_3C_2.txt.gz) and then combined together to get enough reads for further analysis. 3C-seq reads from different samples were divided according to sample barcodes (CCAT1-L knockdown: ATGTCA; Scr: GCCAAT) and different bait sequences, and then mapped to human reference genome to assess chromatin interaction strength between CCAT1-L and MYC locus in different treatments. In our study, one representative bait-specific sequencing data (CTTCTACTGATTGGCCCTAAACACTTTTCCAAAGCTT) was select to generate bedgraph files and upload to UCSC for visualization to show the chromatin interaction between CCAT1-L and Myc locus in CCAT1-L knockdown (CCAT1-L_knockdown_out.bedgraph) and scramble knockdown (Scr_out.bedgraph) samples.
Project description:We knockdown-expressed the AHNAK2 in Hela cells, MDA-MB-231 cells and HCT116 cells using the lentiviral construct Plko.1. Then using RNA-sequencing (Illumina) to compare AHNAK2 knockdown cells to the scramble controls.
Project description:Our previous studies on brains and hearts of Cx null mice have revealed that expression level, control and coordination of a very large number of genes are regulated compared to wildtype littermates. This result suggests the possibility that the phenotype of the Cx null animals may include genes not only linked to the intracellular communication that gap junction channels provide but also to genes with very different functions. The question often arises, however, of the degree to which “compensation” occurs in knockouts such that gene regulation depends on pathways altered to make up for the missing gene rather than reflecting normal gene interlinkage. In order to explore this question in the Cx43 null setting, we have compared gene expression patterns in Cx43 null astrocytes with that in wildtype astrocytes acutely treated (36 hrs) with Cx43 siRNA. In these studies, Cx43 levels determined by Western blot analysis were reduced by at least 70% following siRNA treatment, comparable with the 3.24x downregulation for mRNA. For each group of astrocytes, four independent cultures were compared, using oligonucleotide microarrays printed with the mouse Qiagen library. 8060 well annotated unigenes were identifiable in all 8 arrays; of these, 8.2% were upregulated and 6.0% downregulated in Cx43 null astrocytes and 6.2% upreguated and 7.0 downregulated in siRNA treated astrocytes. Interestingly, regulation of 92.3% unigenes significantly regulated in both Cx43 deficient astrocytes had the same orientation, representing a highly significant overlap of gene expression alteration. These experiments thus indicate that the gene regulation in Cx43 null astrocytes is largely due to direct interlinkage rather than to developmental compensation for the missing gene. Keywords: genetic modification
Project description:CCAT1-L is a highly expressed long noncoding RNA located in the colorectal cancer specific super enhance region about 500 kb upstream of MYC gene. Knockdown of CCAT1-L significantly down-regulated interaction frequency between CCAT1 and MYC locus and repress MYC expression, suggesting a long-range chromatin interaction between CCAT1-L and MYC locus maintained by CCAT1-L underlie the MYC regulation. To further validate this hypothesis, multiplexed 3C sequencing (3C-seq) was employed to evaluate chromatin interaction strength between CCAT1-L and MYC locus in CCAT1-L knockdown and scramble knockdown (Scr) HT29 cells.
Project description:Cy3-labeled cDNA from brains of neonatal C57BL Cx43 null, Cx43 heterozygous and Cx32 null mice were compared among themselves and to Cy3-labeled cDNA from brains of neonatal C57BL wildtype mice through Cy5-labeled sample reference prepared at once for the entire experiment from aorta, brain, heart, kidney, liver, lung, ovary/testicles, spleen, and stomach - equal amounts from adult male and female C57BL mice.
Project description:To identify proteins regulated by TRMT6/TRMT61A complex, we depleted TRMT6/TRMT61A in human liver CSCs, and compared the differential proteins with control CSCs by LC-MS/MS.