Ontology highlight
ABSTRACT:
PROVIDER: PRJNA602319 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:This study investigated the microbial community of rock varnish Based on consensus sequences for 16S OTUs
2013-04-26 | E-GEOD-46347 | biostudies-arrayexpress
Project description:Pouchitis is a common complication for ulcerative colitis (UC) patients with ileal pouch-anal anastomosis (IPAA) surgery. Similarly to IBD, both innate host factors such as genetics, and environmental stimuli including the tissue-associated microbiome have been implicated in the pathogenesis. In this study, we make use of the IPAA model of inflammatory bowel disease (IBD) to carry out a study associating mucosal host gene expression with the microbiome and corresponding clinical outcomes. In order to determine how host gene expression might influence, or be influenced by the tissue associated microbiome, we analyzed 205 IPAA patients with biopsies collected from the pouch and afferent limb for host transcriptomics and 16S rDNA gene sequencing. Metadata included antibiotic use, inflammation score, and clinical classification. To achieve power for a genome-wide microbiome-transcriptome association study, we used principal component analysis to reduce OTUs and host transcripts to eigengenes and eigenclades explaining 50% of observed variance. These were subsequently tested for significant covariation with one another and/or outcome using multivariate linear modeling.
2015-01-27 | E-GEOD-65270 | biostudies-arrayexpress
Project description:To determine microbiota composition associated with loss of KDM5 in intestine, we carried out 16S rRNA seq analyses of dissected intestine from wildtype and kdm5 mutant. [GSM2628181-GSM2628190]. A total of 78 operational taxonomic units (OTUs) were identified in the sequence data. There were about 15 genera much less abundant in kdm5 mutant compared to wildtype. The kdm5 mutant were sensitive to pathogen. To confirm the microbiota associated with loss of KDM5 in intestine, 16S rRNA of new flies were sequenced and analyzed by Majorbio Bio-Pharm Technology Co. Ltd. (Shanghai, China) [GSM3243472-GSM3243481]. A total of 107 operational taxonomic units (OTUs) were identified in the sequence data. There were about 20 genera much less abundant in kdm5 mutant compared to wildtype. To confirm the microbiota associated with loss of KDM5 drosophila feeding with Lactobacillus plantarum, 16S rRNA of kdm5 mutant flies were sequenced and analyzed by Novogene Bioinformatics Technology Co., Ltd. (Tianjin, China) [GSM3263522-GSM3263527]. A total of 92 operational taxonomic units (OTUs) were identified in the sequence data. To confirm the microbiota associated with KDM5 knockdown in intestine, 16S rRNA of Myo1A-Gal4TS/+ and Myo1A-Gal4TS/+;+/kdm5RNAi flies were sequenced and analyzed by Biomarker Co. Ltd. (Beijing, China). [GSM3507915-GSM3507924]. A total of 50 operational taxonomic units (OTUs) were identified in the sequence data. There was a significant different based on the genus level between two groups.
2019-02-08 | GSE98944 | GEO
Project description:Fresh fish are highly perishable food products and their short shelf-life limits their commercial exploitation, leads to waste and has a negative impact on aquaculture sustainability. New non-thermal food processing methods, such as High pressure (HP), are being investigated to prolong shelf-life while assuring high food quality. We applied several tools to evaluate the impacts of HP processing on European sea bass (Dicentrarchus labrax) fillets quality and shelf life. The data here presented includes visual and physical measurements of flesh quality and the microbiome and proteome profiles of control and HP-processed sea bass fillets (600MPa, 25ºC, 5min), after isothermal storage (2°C) for different periods ranging from 1 to 67 days. Color (L-, a- and b- values) change and texture (hardness, cohesiveness and adhesiveness) parameters were obtained by using appropriate colorimeter and texture analyser, respectively, during refrigerated storage. Bacterial diversity was analysed by Illumina high-throughput sequencing of the 16S rRNA gene in five pooled DNAs from control or HP-processed fillets after 1, 11 or 67 days and the raw reads were deposited in the NCBI-SRA database with accession number PRJNA517618. In addition, high-throughput sequencing of the internal transcribed spacer (ITS) region targeting yeast and moulds was run for control or HP-processed fillets at the end of storage (11 or 67 days, respectively), being deposited under SRA accession PRJNA517779. Quantitative label-free proteomics profiles were analysed by SWATH-MS (Sequential Windowed data independent Acquisition of the Total High-resolution-Mass Spectra) in myofibrillar or sarcoplasmic enriched protein extracts pooled for control or HP-processed filets after short (1d) or long-term (11-67 days) storage. These data support the findings reported in “High pressure processing of European sea bass (Dicentrarchus labrax) fillets and tools for flesh quality and shelf life monitoring” (Tsironi et al. 2019).
2019-11-06 | PXD012737 | Pride
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.
2022-04-02 | GSE199749 | GEO
Project description:We investigated the effect of feeding mice a Total Western Diet formulated using the 50th percentile daily intake levels for macro and micronutrients from the National Health and Nutrition Examination Survey (NHANES) with 0, 2, 5, or 10% added raw potato starch on the cecal microbiome (16S) and cecum, proximal and distal colon gene expression by RNASeq analysis.
2022-04-13 | GSE182457 | GEO
Project description:We investigated the effect of feeding mice a Total Western Diet formulated using the 50th percentile daily intake levels for macro and micronutrients from the National Health and Nutrition Examination Survey (NHANES) with 0, 2, 5, or 10% added raw potato starch on the cecal microbiome (16S) and cecum, proximal and distal colon gene expression by RNASeq analysis.
2022-04-13 | GSE182456 | GEO
Project description:We investigated the effect of feeding mice a Total Western Diet formulated using the 50th percentile daily intake levels for macro and micronutrients from the National Health and Nutrition Examination Survey (NHANES) with 0, 2, 5, or 10% added raw potato starch on the cecal microbiome (16S) and cecum, proximal and distal colon gene expression by RNASeq analysis.
2022-04-13 | GSE182454 | GEO
Project description:Age-dependent changes of the gut-associated microbiome have been linked to increased frailty and systemic inflammation. This study found that age-associated changes of the gut microbiome of BALB/c and C57BL/6 mice could be reverted by co-housing of aged (22 months old) and adult (3 months old) mice for 30-40 days or faecal microbiota transplantation (FMT) from adult into aged mice. This was demonstrated using high-throughput sequencing of the V3-V4 hypervariable region of bacterial 16S rRNA gene isolated from faecal pellets collected from 3-4 months old adult and 22-23 months old aged mice before and after co-housing or FMT.
2019-05-08 | E-MTAB-7750 | biostudies-arrayexpress
Project description:Understanding natural defence mechanisms against parasites can be a valuable tool for the development of innovative therapies. In this study, we investigated the interplay between the gill mucus metabolome and microbiome of Chaetodon lunulatus, a butterflyfish known to avoid gill monogeneans whilst living amongst closely related parasitized species. In an attempt to identify metabolites and OTUs potentially involved in parasite defence mechanisms, we studied the metabolome (LC-MS/MS) and microbiome of several sympatric butterflyfish species, including the only non-parasitized species C. lunulatus. After observing significant differences between the metabolome and microbiome of parasitized versus non-parasitized fish (PCoA, ANOSIM), we obtained the discriminant metabolites and OTUs using a supervised analysis. Some of the most important discriminant metabolites were identified as peptides, and three new β-subunit haemoblogin-derived peptides from C. lunulatus (CLHbβ-1, CLHbβ-2 and CLHbβ-3) were purified, characterised and synthesised. We also identified specific bacterial families and OTUs typical from low-oxygen habitats in C. lunulatus gill mucus. By using a correlation network between the two datasets, we found a Fusobacteriaceae strain exclusively present in C. lunulatus highly correlated to the peptides. Finally, we discuss the possible involvement of these peptides and Fusobacteriaceae in monogenean avoidance by this fish species.
2020-11-25 | PXD018867 | Pride