Ontology highlight
ABSTRACT:
PROVIDER: PRJNA607069 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR11096038.fastq.gz | Fastqsanger.gz | |||
| SRR11096039.fastq.gz | Fastqsanger.gz | |||
| SRR11096040.fastq.gz | Fastqsanger.gz | |||
| SRR11096041.fastq.gz | Fastqsanger.gz | |||
| SRR11096042.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 30 |
Similar Datasets
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage.
2015-03-04 | GSE61099 | GEO
Project description:Genome editing typically involves recombination between donor nucleic acids and genomic sequences subjected to double-stranded DNA breaks (DSBs) made by programmable nucleases (e.g. CRISPR-Cas9). Yet, amongst other deleterious by-products, DSBs yield translocations, off-target mutations and, most pervasively, unpredictable on-target allelic disruptions. Remarkably, hitherto, the untoward phenotypic consequences of on-target disruptions at allelic and non-allelic (e.g. pseudogene) sequences have received scant scrutiny and, crucially, remain to be addressed. Here, we demonstrate that gene-edited cells can lose fitness due to on-target DSBs and report that simultaneous single-stranded DNA break formation at donor and target DNA by CRISPR-Cas9 “nickases” overcomes, to a great extent, such genotype-phenotype disrupting events. Moreover, in trans paired nicking gene editing can efficiently and precisely add large DNA segments (i.e. live-cell reporter tags) into essential and multiple-copy genomic sequences while circumventing most of the allelic and non-allelic collateral mutations and chromosomal rearrangements characteristic of nuclease-dependent gene editing procedures.
2019-12-04 | GSE135064 | GEO
Project description:Characterization of RNA cleavage and PFS recognition by CRISPR-Cas12a3 and Cas12a4 nucleases
| PRJEB88250 | ENA
Project description:Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage
| PRJNA316460 | ENA
Project description:We report the PAMs of diverse type I-E CRISPR- Cas systems and the type I-C and the type I-F1 CRISPR-Cas systems from Xanthomonas albilineans. Furthermore, we report PAMs of two type I-B CRISPR transposons (CASTs) and the Vibrio cholerae type I-F CAST. For identification of the PAMs, we used a cell-free TXTL-based PAM screen we named PAM-DETECT. By adding a 5N randomized PAM library and plasmids encoding for Cascade genes and gRNAs, recognized PAMs were bound by Cascade and protected from cleavage by a restriction enzyme that has it's recognition site within the target region. By amplifying the non-cleaved target plasmid, we used next-generation sequencing to analyze the enrichment of functional PAMs of the studied CRISPR-Cas systems. We additionally assessed the insertion sites of crRNA-dependent and crRNA-independent transposition of the Rippkaea orientalis type I-B CAST in TXTL and E. coli.
2022-02-24 | GSE179614 | GEO
Project description:We report the PAMs of phylogenetically-diverse Cas12a nucleases using a cell-free TXTL-based PAM screen. By adding a 5N randomized PAM library and Cas12a-gRNA in vitro, recognized PAM sequences were cleaved, while non-recognized PAMs remained. By amplifying the non-cleaved DNA, we used next-generation sequencing to analyze the depletion of functional PAMs of these Cas12a nucleases.
2020-03-02 | GSE130377 | GEO