Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: 16S rDNA of soil raw sequence reads

PROVIDER: PRJNA610267 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR11237100.fastq.gz	Fastqsanger.gz
	SRR11237101.fastq.gz	Fastqsanger.gz
	SRR11237102.fastq.gz	Fastqsanger.gz
	SRR11237103.fastq.gz	Fastqsanger.gz
	SRR11237104.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 45

Similar Datasets

Morus alba Raw protein sequence reads

Project description:Morus alba L. Raw protein sequence reads and sequence

2024-02-08 | PXD049451 |

16s rDNA of desertified soil

Project description:16s rDNA of desertified soil Raw sequence reads

| PRJNA474072 | ENA

soil metagenome

Project description:bacteria strain:16S rDNA | isolate:16S rDNA Raw sequence reads

| PRJNA301176 | ENA

bacterium_enrichment_culture_clone_Anammox_2

Project description:biofilm 16s rDNA Raw sequence reads

| PRJNA1154400 | ENA

uncultured prokaryote

Project description:seawater 16s rDNA Raw sequence reads

| PRJNA389153 | ENA

16S rDNA sequencing

Project description:16S rDNA sequencing Raw sequence reads

| PRJNA882208 | ENA

High-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.

2022-04-02 | GSE199749 | GEO

Soil from private agricultural land

Project description:Soil Microbiome 16S rDNA Next-generation Sequencing - Raw Sequence Reads

| PRJNA896987 | ENA

Generation of Hematopoietic TF-rDNA Atlas in Human and Mouse

Project description:Over 2000 publicly accessible human and mouse ChIP-Seq datasets for about 250 Transcription Factors and chromatin complexes from various databases (ENCODE, GEO) were mapped to custom-made human and mouse genomes containing a reference rDNA sequence of the appropriate species (Genbank U13369.1 for human, BK000964.3 for mouse). The read mapping density across the rDNA sequence was then extracted and normalized to the median in that dataset. Unbiased clustering and analysis, followed by curation, was performed to identify high-confidence patterns of rDNA occupancy for numerous hematopoietic TFs and TF families at canonical TF motif sequences. ************************ Data processing steps: FASTQs were trimmed using Trimmomatic with the following parameters: LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:30 Reads were mapped to customized genomes (containing additional rDNA sequence) using Bowtie2 using the following parameter: -X 2000 Read density across the rDNA sequence was extracted using igvtools ************************

2022-01-15 | GSE191272 | GEO

air metagenome

Project description:bioaerosol 16S rRNA/rDNA Raw sequence reads

| PRJNA394786 | ENA