Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: 16S rDNA High throughput sequencing of soil

PROVIDER: PRJNA638003 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR11947764_1.fastq.gz	Fastqsanger.gz
	SRR11947764_2.fastq.gz	Fastqsanger.gz
	SRR11947765_1.fastq.gz	Fastqsanger.gz
	SRR11947765_2.fastq.gz	Fastqsanger.gz
	SRR11947766_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 60

Similar Datasets

Project description:16S rDNA High throughput sequencing of soil

| PRJNA728746 | ENA

Project description:18S rDNA High throughput sequencing of soil

| PRJNA722569 | ENA

Project description:Soil 16S high-throughput sequencing

| PRJNA967487 | ENA

Project description:Soil 16S rRNA high-throughput sequencing

| PRJNA1442752 | ENA

Project description:soil 16S rRNA high-throughput sequencing

| PRJNA776560 | ENA

High-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.

2022-04-02 | GSE199749 | GEO

Isolation and Characterization of a Novel Streptomyces murinus Strain with Dual Activities: Biocontrol of Maize Foliar Pathogens and Growth Promotion

Project description:This study evaluated the biocontrol efficacy, growth-promoting potential, and molecular mechanisms of the actinomycete strain FJSM-07, identified via 16S rDNA sequencing as Streptomyces murinus.

2026-07-14 | GSE338066 | GEO

Project description:high-throughput sequencing soil 16S rRNA gene

| PRJNA800347 | ENA

Sleep deprivation disturbs diurnal rhythmicity of gut microbiota and inflammatory responses in mice

Project description:Six- to eight-week old CD1 male mice were sleep-deprived for 24 hours by placing them in a small platform in a water tank. Their ileum samples were harvested every 4 hours on the next day (time point: ZT1,ZT5,ZT9,ZT13,ZT17,ZT21). The ileum samples were subjected to 16s rDNA sequencing. Control group (C1,C5,C9,C13,C17,C21, n=36). SD group (SD1,SD5,SD9,SD13,SD17,SD21, n=36).

2025-08-29 | E-MTAB-15462 | biostudies-arrayexpress

Project description:16s rDNA high-throughput sequencing of ileum, colon, and cecum contents

| PRJNA656109 | ENA