Project description:Sensitive models of climate change impacts would require a better integration of multi-omics approaches that connect the abundance and activity of microbial populations. Here, we show that climate is a fundamental driver of the protein abundance of microbial populations (metaproteomics), yet not their genomic abundance (16S rRNA gene amplicon sequencing), supporting the hypothesis that metabolic activity may be more closely linked to climate than community composition.
Project description:Gut microbiota were assessed in 540 colonoscopy-screened adults by 16S rRNA gene sequencing of stool samples. Investigators compared gut microbiota diversity, overall composition, and normalized taxon abundance among these groups.
Project description:In this study we developed metaproteomics based methods for quantifying taxonomic composition of microbiomes (microbial communities). We also compared metaproteomics based quantification to other quantification methods, namely metagenomics and 16S rRNA gene amplicon sequencing. The metagenomic and 16S rRNA data can be found in the European Nucleotide Archive (Study number: PRJEB19901). For the method development and comparison of the methods we analyzed three types of mock communities with all three methods. The communities contain between 28 to 32 species and strains of bacteria, archaea, eukaryotes and bacteriophage. For each community type 4 biological replicate communities were generated. All four replicates were analyzed by 16S rRNA sequencing and metaproteomics. Three replicates of each community type were analyzed with metagenomics. The "C" type communities have same cell/phage particle number for all community members (C1 to C4). The "P" type communities have the same protein content for all community members (P1 to P4). The "U" (UNEVEN) type communities cover a large range of protein amounts and cell numbers (U1 to U4). We also generated proteomic data for four pure cultures to test the specificity of the protein inference method. This data is also included in this submission.
Project description:Purpose: This study aims to compare and analyze the differences in bacterial community composition in fecal samples from mice treated with Control(DW), Vancomycin (VAN), Ampicillin (AMP), Neomycin (NEO), Metronidazole (MET), and a combination of all antibiotics (ALL, VANM) using 16S rRNA sequencing. Methods: Each antibiotics treated mice's fecal samples were collected and stored -80'c until analyzation. DNA was extracted using the NucleoSpin DNA Stool Kit (MACHEREY-NAGEL) following the manufacturer’s protocol. Metagenomic sequencing was performed on an Illumina MiSeq platform (Illumina), targeting the V3 and V4 regions of the 16S rRNA gene according to the manufacturer's instructions. PCR products were purified using AMPure XP beads, and sequencing adapters were added using the Nextera XT Index Kit (Illumina). The library was further purified with AMPure XP beads and quantified using automated electrophoresis with the TapeStation System (Agilent). Sequencing was performed using the MiSeq v3 reagent kit (Illumina), following the manufacturer’s protocol. Results: QIIME2 (v2023.02) was used to process and analyze 16S rRNA gene amplicon sequencing data, from sequence preprocessing to taxonomic classification. Paired-end sequences were merged and quality-filtered using Deblur. The resulting amplicon sequence variants (ASVs) were used for downstream analyses. Conclusions: Our study presents a comparative analysis of bacterial community composition in fecal samples from antibiotic-treated mice. We observed that microbiota composition varied distinctly depending on the type of antibiotic administered.
Project description:The impact of mono-chronic S. stercoralis infection on the gut microbiome and microbial activities in infected participants was explored. The 16S rRNA gene sequencing of a longitudinal study with 2 sets of human fecal was investigated. Set A, 42 samples were matched, and divided equally into positive (Pos) and negative (Neg) for S. stercoralis diagnoses. Set B, 20 samples of the same participant in before (Ss+PreT) and after (Ss+PostT) treatment was subjected for 16S rRNA sequences and LC-MS/MS to explore the effect of anti-helminthic treatment on microbiome proteomes.
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
Project description:Because of severe abiotic limitations, Antarctic soils represent simplified ecosystems, where microorganisms are the principle drivers of nutrient cycling. This relative simplicity makes these ecosystems particularly vulnerable to perturbations, like global warming, and the Antarctic Peninsula is among the most rapidly warming regions on the planet. However, the consequences of the ongoing warming of Antarctica on microorganisms and the processes they mediate are unknown. Here, using 16S rRNA gene pyrosequencing and qPCR, we report a number of highly consistent changes in microbial community structure and abundance across very disparate sub-Antarctic and Antarctic environments following three years of experimental field warming (+ 0.5-2°C). Specifically, we found significant increases in the abundance of fungi and bacteria and in the Alphaproteobacteria-to-Acidobacteria ratio. These alterations were linked to a significant increase in soil respiration. Furthermore, the shifts toward generalist or opportunistic bacterial communities following warming weakened the linkage between bacterial diversity and functional diversity. Warming also increased the abundance of some organisms related to the N-cycle, detected as an increase in the relative abundance of nitrogenase genes via GeoChip microarray analyses. Our results demonstrate that soil microorganisms across a range of sub-Antarctic and Antarctic environments can respond consistently and rapidly to increasing temperatures, thereby potentially disrupting soil functioning.
Project description:16S rRNA V3-V4 amplicon sequencing was performed on fecal samples from 12 male C57BL/6J mice across three groups (4 replicates each): Control (distilled water, 3 days), Model (distilled water, 3 days + APAP 300 mg/kg i.p.), and PoH (PO extract 3 g/kg p.o. daily for 3 days + APAP 300 mg/kg i.p.). Sequencing was performed on an Illumina NovaSeq 6000 platform using paired-end 250bp reads.
Project description:Because of severe abiotic limitations, Antarctic soils represent simplified ecosystems, where microorganisms are the principle drivers of nutrient cycling. This relative simplicity makes these ecosystems particularly vulnerable to perturbations, like global warming, and the Antarctic Peninsula is among the most rapidly warming regions on the planet. However, the consequences of the ongoing warming of Antarctica on microorganisms and the processes they mediate are unknown. Here, using 16S rRNA gene pyrosequencing and qPCR, we report a number of highly consistent changes in microbial community structure and abundance across very disparate sub-Antarctic and Antarctic environments following three years of experimental field warming (+ 0.5-2°C). Specifically, we found significant increases in the abundance of fungi and bacteria and in the Alphaproteobacteria-to-Acidobacteria ratio. These alterations were linked to a significant increase in soil respiration. Furthermore, the shifts toward generalist or opportunistic bacterial communities following warming weakened the linkage between bacterial diversity and functional diversity. Warming also increased the abundance of some organisms related to the N-cycle, detected as an increase in the relative abundance of nitrogenase genes via GeoChip microarray analyses. Our results demonstrate that soil microorganisms across a range of sub-Antarctic and Antarctic environments can respond consistently and rapidly to increasing temperatures, thereby potentially disrupting soil functioning. We conducted in situ warming experiments for three years using open-top chambers (OTCs) at one sub-Antarctic (Falkland Islands, 52ºS) and two Antarctic locations (Signy and Anchorage Islands, 60ºS and 67ºS respectively) (see Supplementary Fig. 1 for a map). OTCs increased annual soil temperature by an average of 0.8°C (at a depth of 5 cm), resulting in 8-43% increase in positive-degree days annually and a decrease in freeze-thaw cycle frequency by an average of 15 cycles per year (8). At each location, we included densely vegetated and bare fell-field soils in the experimental design for a total of six environments. Densely vegetated and bare environments represent two contrasting environments for Antarctic soil microorganisms, with large differences in terms of C and N inputs to soils. Massively parallel pyrosequencing (Roche 454 GS FLX Titanium) of 16S rRNA gene amplicons was used to follow bacterial diversity and community composition [GenBank Accession Numbers: HM641909-HM744649], and functional gene microarrays (GeoChip 2.0)(11) were used to assess changes in functional gene distribution. Bacterial and fungal communities were also quantified using real-time PCR.