Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: Microbial 16S Amplicon Sequencing of cecal content samples from ApoE KO mice

PROVIDER: PRJNA667205 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR12772300_1.fastq.gz	Fastqsanger.gz
	SRR12772300_2.fastq.gz	Fastqsanger.gz
	SRR12772301_1.fastq.gz	Fastqsanger.gz
	SRR12772301_2.fastq.gz	Fastqsanger.gz
	SRR12772302_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 120

Similar Datasets

Project description:Microbial 16S Amplicon Sequencing of cecal content samples from C57BL/6J mice

| PRJNA667196 | ENA

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

16S rRNA sequencing of cecal microbiota from neonatal mice pre- and post-weaning

Project description:Neonatal mice were susceptible to cryptosporidium infection at 1- and 2-weeks of age, but were resistant to infection at 3- and 6-weeks of age. Diet and microbial changes are known to occur during the weaning transition in mice and we hypothesized that these changes in the intestinal luminal environment might influence resistance and susceptibility to cryptosporidium infection. As one part of testing this hypothesis, cecal microbiota composition was determined by 16S ribosomal RNA sequencing of DNA isolated from the cecal contents of mice at 1 week, 2 weeks, 3 weeks, and 6 weeks of age.

2020-11-03 | E-MTAB-9100 | biostudies-arrayexpress

Murine cecal contents

Project description:Murine cecal content comparative 16S amplicon sequencing

| PRJNA776696 | ENA

Chicken cecal content

Project description:16S amplicon sequencing of chicken cecal content

| PRJNA1080234 | ENA

Whole rye consumption improves blood and liver n-3 fatty acid profile and gut microbiota composition in rats

Project description:This study in rats was designed to investigate whether whole rhye (WR) can influence the metabolism of n-3 and n-6 long-chain fatty acids (LCFA) and gut microbiota composition. For 12 weeks, rats were fed a diet containing either 50% WR or 50% refined rye (RR). Total bacterial DNA was extracted from fecal and cecal samples (n=5 per group). 16S PCR amplification was performed to assess the microbial diversity at the family level using the HuGChip. Amplified DNA was purified and labelled with either Cy3 or Cy5 dye and hybridized on the microarray. A 15 chip study was realized, each corresponding to hybridization with 250ng of labelled 16S rRNA gene amplicons from either mice fecal and cecal samples. Each probe (4441) was synthetized in three replicates.

2015-08-06 | E-GEOD-71726 | biostudies-arrayexpress

Soil Metaproteomics LC-MS

Project description:Sensitive models of climate change impacts would require a better integration of multi-omics approaches that connect the abundance and activity of microbial populations. Here, we show that climate is a fundamental driver of the protein abundance of microbial populations (metaproteomics), yet not their genomic abundance (16S rRNA gene amplicon sequencing), supporting the hypothesis that metabolic activity may be more closely linked to climate than community composition.

2022-03-01 | PXD009773 | Pride

Co-exposure to Polyethylene Fiber and Salmonella enterica Typhimurium Alters Microbiome and Metabolome of in vitro Chicken Cecal Mesocosms

Project description:Humans and animals encounter a summation of exposures during their lifetime (the exposome). In recent years, the scope of the exposome has begun to include microplastics. Microplastics (MPs) have increasingly been found in locations where there could be an interaction with Salmonella enterica Typhimurium, one of the commonly isolated serovars from processed chicken. In this study, the microbiota response to a 24-hour co-exposure to Salmonella enterica Typhimurium and/or low-density polyethylene (PE) microplastics in an in vitro broiler cecal model was determined using 16S rRNA amplicon sequencing (Illumina) and untargeted metabolomics. Community sequencing results indicated that PE fiber with and without S. Typhimurium yielded a lower Firmicutes/Bacteroides ratio compared to other treatment groups, which is associated with poor gut health, and overall had greater changes to the cecal microbial community composition. However, changes in the total metabolome were primarily driven by the presence of S. Typhimurium. Additionally, the co-exposure to PE Fiber and S. Typhimurium caused greater cecal microbial community and metabolome changes than either exposure alone. Our results indicate that polymer shape is an important factor in effects resulting from exposure. It also demonstrates that microplastic-pathogen interactions cause metabolic alterations to the chicken cecal microbiome in an in vitro chicken cecal model.

2024-07-08 | MTBLS9001 | MetaboLights

Quantification of mock microbial communities with metagenomes, 16S rRNA gene amplicons and metaproteomics

Project description:In this study we developed metaproteomics based methods for quantifying taxonomic composition of microbiomes (microbial communities). We also compared metaproteomics based quantification to other quantification methods, namely metagenomics and 16S rRNA gene amplicon sequencing. The metagenomic and 16S rRNA data can be found in the European Nucleotide Archive (Study number: PRJEB19901). For the method development and comparison of the methods we analyzed three types of mock communities with all three methods. The communities contain between 28 to 32 species and strains of bacteria, archaea, eukaryotes and bacteriophage. For each community type 4 biological replicate communities were generated. All four replicates were analyzed by 16S rRNA sequencing and metaproteomics. Three replicates of each community type were analyzed with metagenomics. The "C" type communities have same cell/phage particle number for all community members (C1 to C4). The "P" type communities have the same protein content for all community members (P1 to P4). The "U" (UNEVEN) type communities cover a large range of protein amounts and cell numbers (U1 to U4). We also generated proteomic data for four pure cultures to test the specificity of the protein inference method. This data is also included in this submission.

2017-05-12 | PXD006118 | Pride

Experimental tests strongly challenge the evidence of a healthy human blood microbiome

Project description:The study critically evaluate the results of 16S targeted amplicon sequencing performed on the total DNA collected from healthy donors’ blood samples in the light of specific negative controls.

2024-03-01 | GSE254843 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data