Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Fecal sample

ABSTRACT: Microbial diversity in feces of mice with colitis

PROVIDER: PRJNA669266 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR12853000_1.fastq.gz	Fastqsanger.gz
	SRR12853000_2.fastq.gz	Fastqsanger.gz
	SRR12853001_1.fastq.gz	Fastqsanger.gz
	SRR12853001_2.fastq.gz	Fastqsanger.gz
	SRR12853002_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 226

Similar Datasets

Fecal sample

Project description:Fecal microbial community diversity

| PRJNA376836 | ENA

mice fecal sample

Project description:mice fecal microbial community analysis

| PRJNA473033 | ENA

pig fecal

Project description:Sequencing of microbial diversity in pig feces

| PRJNA656403 | ENA

Identification of differentially expressed fecal miRNA in hepatic encephalopathy

Project description:To further identify the fecal miRNAs generated in HE, we conducted an miRNA microarray analysis on feces collected from patients with HE and CHB. The microarray analysis of miRNA expression profiles revealed that the abundance of 10 miRNAs was significantly increased in feces from patients with HE, as compared with that from patients with CHB, whereas the abundance of 8 miRNAs was decreased.

2023-04-19 | GSE228731 | GEO

Fecal microbiota in mice before and after repeated mild stress

Project description:To examine potential changes of the intestinal microbiota in mice caused by repeated mild stress, we profiled bacteria and fungi in the mouse feces by sequencing the 16s v3v4 region and the ITS1-2 region.

2024-09-23 | GSE222533 | GEO

Gut microbiota analysis in WT and Il17d-deficient mice treated with or without colitis

Project description:Microbiota dysbiosis has been reported to contribute to the pathogenesis of colitis, to demonstrate whether IL-17D protects against DSS-induced colitis through regulation of microflora, we performed 16S rRNA sequencing in feces from WT and Il17d-deficient mice. Our data indicate that Il17d deficiency results in microbiota dysibiosis in both steady state and DSS-induced colitis.

2021-05-20 | GSE165789 | GEO

High-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.

2022-04-02 | GSE199749 | GEO

Project description:mice feces microbial community diversity

| PRJNA1210779 | ENA

Project description:mice feces microbial community diversity

| PRJNA661138 | ENA

Project description:mice feces microbial community diversity

| PRJNA1068291 | ENA