CRAC of Nab3 in yeast cells accumulating a circular RNA containing Nab3 binding sites (the decoy) or an empty control
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA691262 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR13403360.fastq.gz | Fastqsanger.gz | |||
| SRR13403361.fastq.gz | Fastqsanger.gz | |||
| SRR13403362.fastq.gz | Fastqsanger.gz | |||
| SRR13403363.fastq.gz | Fastqsanger.gz | |||
| SRR13403364.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 6 |
Similar Datasets
Project description:We report the analysis of in vivo, genomewide binding of Nab3 under conditions in which non-degradable targets of Nab3 accumulate. We aimed at mimicking the effect of defective degradation of non-coding RNAs (Cryptic Unstable Transcripts, CUT) that can be bound by Nab3 on the co-transcriptional recruitment of Nab3 for transcription termination.
2021-01-12 | GSE164587 | GEO
Project description:Using CRAC, we compared the transcriptomic occupancy of Nab3 in a Saccharomyces cerevisiae BY4741 parental strain (PIC2-GFP) and two derived mutants lacking Nab3 RNA-binding sites in PIC2. The purpose of the experiment was two-fold: on the one hand, we aimed to verify that the mutations inserted in the Nab3 binding sequences of PIC2 had indeed abrogated binding of Nab3 to the PIC2 transcript; on the other hand, we wanted to check whether differential binding of Nab3 to PIC2 would affect how the protein bound other targets in the genome. Sequencing outputs were processed using the pyCRAC pipeline and peak calling was performed with DBPeaks, our newly developed package for identification and comparison of binding sites defined by RNA-binding footprinting techniques (e.g., CRAC, iCLIP, PAR-CLIP, etc.).
2025-08-25 | GSE276517 | GEO
Project description:Using CRAC, we compared the transcriptomic occupancy of Nrd1 in a Saccharomyces cerevisiae BY4741 parental strain (PIC2-GFP) and two derived mutants lacking Nab3 RNA-binding sites in PIC2. The purpose of the experiment was two-fold: on the one hand, we aimed to verify that the mutations inserted in the Nab3 binding sequences of PIC2 affected the binding of Nrd1 to the PIC2 transcript; on the other hand, we wanted to check whether differential binding of Nab3 to PIC2 would affect how the protein bound other targets in the genome. Sequencing outputs were processed using the pyCRAC pipeline and peak calling was performed with DBPeaks, our newly developed package for identification and comparison of binding sites defined by RNA-binding footprinting techniques (e.g., CRAC, iCLIP, PAR-CLIP, etc.).
2025-08-25 | GSE276519 | GEO
Project description:Using CRAC, we compared the transcriptomic occupancy of Sen1 in a Saccharomyces cerevisiae BY4741 parental strain (PIC2-GFP) and two derived mutants lacking Nab3 RNA-binding sites in PIC2. The purpose of the experiment was two-fold: on the one hand, we aimed to verify that the mutations inserted in the Nab3 binding sequences of PIC2 affected the binding of Sen1 to the PIC2 transcript; on the other hand, we wanted to check whether differential binding of Nab3 to PIC2 would affect how the protein bound other targets in the genome. Sequencing outputs were processed using the pyCRAC pipeline and peak calling was performed with DBPeaks, our newly developed package for identification and comparison of binding sites defined by RNA-binding footprinting techniques (e.g., CRAC, iCLIP, PAR-CLIP, etc.).
2025-08-25 | GSE276524 | GEO
Project description:RNA-binding proteins play a key role in shaping gene expression profiles during stress, however, little is known about the dynamic nature of these interactions and how this influences the kinetics of gene expression. To address this, we developed kinetic χCRAC, a UV cross-linking method that enabled us to quantitatively measure the dynamics of protein-RNA interactions in vivo on a minute time-scale. Here, using kinetic χCRAC we measure the global RNA-binding dynamics of the yeast transcription termination factor Nab3 in response to glucose starvation. These measurement reveal rapid changes in protein-RNA interactions within one minute following stress imposition. Changes in Nab3 binding are largely independent of alterations in transcription rate during the early stages of stress response, indicating orthogonal transcriptional control mechanisms. We also uncover a function for Nab3 in dampening expression of stress-responsive genes. Kinetic χCRAC has the potential to greatly enhance our understanding of in vivo dynamics of protein-RNA interactions.
2017-04-11 | GSE85545 | GEO
Project description:Pervasive transcription originating from the ubiquitous activity of RNA Polymerase II (RNAPII) generates a vast mass of non-coding RNAs (ncRNAs) that represent a potential harm to gene expression. In the compact genome of the yeast Saccharomyces cerevisiae, the main genomewide safeguard against pervasive ncRNAs is the Nrd1-Nab3-Sen1 (NNS) complex, composed of two RNA-binding proteins (Nrd1 and Nab3) and the helicase Sen1. The NNS complex directs transcription termination of ncRNA genes and promotes the rapid degradation of pervasive transcripts from yeast nuclei through its physical and functional coupling to the nuclear RNA exosome. We have recently shown that inhibition of the exosome in yeast cells leads to the accumulation of ncRNAs complexed with Nab3 and Nrd1, decreasing recycling of these termination factors to sites of transcription and inducing global termination defects at NNS targets. Consistent with the notion that ncRNAs out-titrate Nab3 and Nrd1 termination factors, we have shown that a similar genomewide termination impairment could be achieved by expressing a circular RNA decoy containing a Nab3 binding target [1]. In relation to this previous research article, here we expand our observations on the effect of the circular RNA decoy on NNS termination. We aimed at verifying that the Nab3 binding sequence present on the decoy is indeed efficiently sequestering Nab3 as intended by design, leading to the expected decrease of Nab3 binding on NNS targets. We employed the crosslinking and cDNA analysis protocol (CRAC) on yeast cells expressing the circular ncRNA decoy or a control construct. We present data from high-resolution genomewide RNA binding of Nab3 in three independent biological replicates of these S.cerevisiae cells, normalized by spiked-in S.pombe lysates. These data allow the useful assessment of the extent of co-transcriptional binding decrease of Nab3 by decoy ncRNA titration and will be valuable for further analyses of NNS targeting mechanisms.
| S-EPMC8020422 | biostudies-literature
Project description:We obtained Nab3, Nrd1, and RNA polymerase II occupancy profiles across the genome of S.cerevisiae in wild-type and rrp6∆ strains. This allowed us to determine the impact of defective nuclear exosome on NNS-dependent transcription termination.
2020-07-24 | GSE137881 | GEO
Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do). genetic_modification_design
2012-08-23 | E-GEOD-39572 | biostudies-arrayexpress
Project description:Nrd1 and Nab3 are two yeast RNA binding proteins which have been shown to be involved in transcription termination of non poly(A) genes. We have used expression profiling of a Nab3 mutant to discover novel RNA targets of the Nrd1 and Nab3 transcription termination pathway. Failure to terminate RNA polymerase II by Nab3 leads to continued transcription well beyond the correct termination sites, altering the expression of adjacent downstream genes. Using this concept, our microarray uncovered the up-regulation of numerous genes that are located downstream of âcryptic unstable transcriptsâ, transcripts that are transcribed, terminated and rapidly degraded by Nrd1, Nab3, and the nuclear exosome. Experiment Overall Design: Four yeast total RNA samples where analyzed in this study. These RNAs come from two separate strains of yeast, each strain at either the permissive temperature (25C) or the non-permissive temperature (37C). One of these strains is a wild type strain of yeast used as a control. The other strain has a mutation in the Nab3 protein that confers temperature sensitivity at the non-permissive temperature of 37C. After two hours at the non-permissive temperature, we observe disruptions in the Nrd1/Nab3 transcription termination pathway and this is the scheme that we followed for our microarray experiment. Our goal was to observe the global expression changes after 2 hours without Nab3 function.
2008-06-13 | E-GEOD-4657 | biostudies-arrayexpress
Project description:Nrd1 and Nab3 are two yeast RNA binding proteins which have been shown to be involved in transcription termination of non poly(A) genes. We have used expression profiling of a Nab3 mutant to discover novel RNA targets of the Nrd1 and Nab3 transcription termination pathway. Failure to terminate RNA polymerase II by Nab3 leads to continued transcription well beyond the correct termination sites, altering the expression of adjacent downstream genes. Using this concept, our microarray uncovered the up-regulation of numerous genes that are located downstream of “cryptic unstable transcripts”, transcripts that are transcribed, terminated and rapidly degraded by Nrd1, Nab3, and the nuclear exosome. Keywords: yeast temperature sensitive mutant 25C vs 37C
2006-05-30 | GSE4657 | GEO