Ontology highlight
ABSTRACT:
PROVIDER: PRJNA730392 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR14563150_1.fastq.gz | Fastqsanger.gz | |||
| SRR14563150_2.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 2 of 2 |
Similar Datasets
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:Genome editing with programmable nucleases has shown great promise for clinical translation but also revealed the risk of genotoxicity caused by chromosomal translocations or the insertion of mutations at off-target sites. Here, we describe CAST-Seq, an innovative assay to identify and quantify chromosomal aberrations derived from on- and off-target activities of CRISPR-Cas nucleases or TALENs. CAST-Seq also detected novel types of chromosomal rearrangements, including homology-mediated translocations that are mediated by homologous recombination. Depending on the employed designer nuclease, translocations occurred in 0–0.5% of gene-edited human stem cells and some 20% of target loci harbored gross aberrations. In conclusion, CAST-Seq analyses are particularly relevant for therapeutic editing of stem cells to enable a thorough risk assessment before clinical application of gene editing products.
2021-02-14 | GSE164389 | GEO
Project description:The type V-I CRISPR-Cas system is becoming increasingly attractive for its potential utility in gene editing. However, natural nucleases often exhibit low efficiency, limiting their application. Here, we utilized structure-guided rational design and combinatorial protein engineering to optimize an uncharacterized Cas12i nuclease, Cas12i3. Accordingly, we developed Cas-SF01, a Cas12i3 variant that exhibits significantly improved gene-editing activity in mammalian cells and plants. Cas-SF01 displays comparable or superior editing performance compared to SpCas9 or recently engineered Cas12 nucleases. Further analysis of PAM recognition showed that Cas-SF01 has an expanded PAM range and effectively recognizes NTTN and noncanonical NATN and TTVN PAMs. Additionally, we identified an amino acid substitution, D876R, that markedly reduced the off-target effect while maintaining high on-target activity, leading to the development of Cas-SF01HiFi (high-fidelity Cas-SF01). Finally, we demonstrated that Cas-SF01 has robust gene-editing activity in both the monocot plant rice and dicot plant pepper. Our results suggest that Cas-SF01 can serve as a robust gene-editing platform with high efficiency and specificity for future genome editing applications across different organisms.
2023-11-05 | GSE236755 | GEO
Project description:CRISPR-Cas is an RNA-based defense system that enables prokaryotes to recognize invading foreign DNA by cognate crRNA guides and destroy it by CRISPR-associated Cas nucleases 1,2 . Elucidation of the interference mechanism of the Streptococcus pyogenes Type II CRISPR- Cas9 system has allowed for the successful repurposing of SpCas9 as a generic genome editing tool, with great promise for human gene therapy 3 . However, especially for therapeutic applications, some caution seems appropriate, because Cas9 systems from some human pathogens may induce a cytotoxic response via an unknown mechanism 4 . Here we show that when released in human cells, Cas9 nucleases from the pathogenic bacteria Campylobacter jejuni and S. pyogenes have the potential to cause severe DNA damage. In the absence of a CRISPR RNA guide, native Cas9 nucleases from both pathogens enter the host nucleus, where their presence leads to promiscuous double stranded DNA breaks (DSBs) and induction of cell death. DSB induction can be reduced to background levels either by saturation of CjCas9 and SpCas9 with crRNA guides or by inactivating their nuclease activity. Our results demonstrate that guide-free Cas9 of bacterial pathogens might play an important role in pathogenicity. Furthermore, we propose that saturating Cas9 with appropriate guide RNAs is crucial for efficient and safe therapeutic applications.
2022-03-02 | PXD006712 | Pride
Project description:The development of CRISPR-Cas systems for targeting DNA and RNA in diverse organisms has transformed biotechnology and biological research. Moreover, the CRISPR revolution has highlighted bacterial adaptive immune systems as a rich and largely unexplored frontier for discovery of new genome engineering technologies. In particular, the class 2 CRISPR-Cas systems, which use single RNA-guided DNA-targeting nucleases such as Cas9, have been widely applied for targeting DNA sequences in eukaryotic genomes. Here, we report DNA-targeting and transcriptional control with class I CRISPR-Cas systems. Specifically, we repurpose the effector complex from type I variants of class 1 CRISPR-Cas systems, the most prevalent CRISPR loci in nature, that target DNA via a multi-component RNA-guided complex termed Cascade. We validate Cascade expression, complex formation, and nuclear localization in human cells and demonstrate programmable CRISPR RNA (crRNA)-mediated targeting of specific loci in the human genome. By tethering transactivation domains to Cascade, we modulate the expression of targeted chromosomal genes in both human cells and plants. This study expands the toolbox for engineering eukaryotic genomes and establishes Cascade as a novel CRISPR-based technology for targeted eukaryotic gene regulation.
2019-06-26 | GSE114858 | GEO
Project description:CRISPR-Cas systems can be utilized as programmable-spectrum antimicrobials to combat bacterial infections. However, how CRISPR nucleases perform as antimicrobials across target sites and strains remains poorly explored. Here, we address this knowledge gap by systematically interrogating the use of CRISPR antimicrobials against multidrug-resistant and hypervirulent strains of Klebsiella pneumoniae. Comparing different Cas nucleases, we found that AsCas12a exhibited robust targeting across different strains. The elucidated modes of escape from this nuclease varied widely, restraining opportunities to enhance killing. We also encountered individual guide RNAs yielding different extents of clearance across strains. The differences were attributed to improper RNA folding, leading to inefficient DNA cleavage and subsequent repair via homologous recombination. To explore features that could improve targeting across strains, we performed a genome-wide screen in different K. pneumoniae strains that yielded guide design rules and trained an algorithm for predicting guide efficiency. Finally, we showed that Cas12a antimicrobials can be exploited to eliminate K. pneumoniae when encoded in phagemids delivered by T7-like phages. Altogether, our results highlight the importance of evaluating antimicrobial activity of CRISPR antimicrobials across relevant strains and define critical parameters for efficient CRISPR-based targeting.
2023-07-17 | GSE237136 | GEO
Project description:The development of CRISPR-Cas systems for targeting DNA and RNA in diverse organisms has transformed biotechnology and biological research. Moreover, the CRISPR revolution has highlighted bacterial adaptive immune systems as a rich and largely unexplored frontier for discovery of new genome engineering technologies. In particular, the class 2 CRISPR-Cas systems, which use single RNA-guided DNA-targeting nucleases such as Cas9, have been widely applied for targeting DNA sequences in eukaryotic genomes. Here, we report DNA-targeting and transcriptional control with class I CRISPR-Cas systems. Specifically, we repurpose the effector complex from type I variants of class 1 CRISPR-Cas systems, the most prevalent CRISPR loci in nature, that target DNA via a multi-component RNA-guided complex termed Cascade. We validate Cascade expression, complex formation, and nuclear localization in human cells and demonstrate programmable CRISPR RNA (crRNA)-mediated targeting of specific loci in the human genome. By tethering transactivation domains to Cascade, we modulate the expression of targeted chromosomal genes in both human cells and plants. This study expands the toolbox for engineering eukaryotic genomes and establishes Cascade as a novel CRISPR-based technology for targeted eukaryotic gene regulation.
2019-06-26 | GSE114857 | GEO
Project description:We employed CRISPR/Cas-mediated genome editing to generate S2 cell lines expressing GFP-tagged dCoREST, dL(3)mbt, dLSD1 and dG9a, respectively. This allowed us to determine the genome-wide binding profiles for these proteins by ChIP-seq using the same antibody (anti-GFP) in each case.
2019-11-04 | E-MTAB-8341 | biostudies-arrayexpress