Ontology highlight
ABSTRACT:
PROVIDER: PRJNA752452 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR15356510_subreads.fastq.gz | Fastqsanger.gz | |||
| SRR15356511_subreads.fastq.gz | Fastqsanger.gz | |||
| SRR15356512_subreads.fastq.gz | Fastqsanger.gz | |||
| SRR15356513_subreads.fastq.gz | Fastqsanger.gz | |||
| SRR15356514_subreads.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 34 |
Similar Datasets
Project description:DNA methylation is a mechanism for long-term transcriptional regulation and is required for normal cellular differentiation. Failure to properly establish or maintain DNA methylation patterns leads to cell dysfunction and diseases such as cancer. Identifying DNA methylation signatures in complex tissues can be challenging due to inaccurate cell enrichment methods and low DNA yields. We have developed a technique called Laser Capture Microdissection-Reduced Representation Bisulfite Sequencing (LCM-RRBS) for the multiplexed interrogation of the DNA methylation status of CpG Islands and promoters. LCM-RRBS accurately and reproducibly profiles genome-wide methylation of DNA extracted from microdissected fresh frozen or formalin-fixed paraffin-embedded tissue samples. To demonstrate the utility of LCM-RRBS, we characterized changes in DNA methylation associated with gonadectomy-induced adrenocortical neoplasia in the mouse. Compared to adjacent normal tissue, the adrenocortical tumors showed reproducible gains and losses of DNA methylation at genes involved in cell differentiation and organ development. LCM-RRBS is a rapid, cost-effective, and sensitive technique for analyzing DNA methylation in heterogeneous tissues and will facilitate the investigation of DNA methylation in cancer and organ development. Laser capture microdissection-reduced representation bisulfite sequencing and reduced representation bisulfite sequencing on human blood leukocyte, human endometrial tumor, mouse liver tissue, and mouse normal and neoplastic adrenal tissue
2013-03-21 | E-GEOD-45361 | biostudies-arrayexpress
Project description:SPO11-promoted DNA double-strand breaks (DSBs) formation is a crucial step for meiotic recombination, and it is indispensable to detect the broken DNA ends accurately for dissecting the molecular mechanisms behind. Here, we report a novel technique, named DEtail-seq (DNA End tailing followed by sequencing), that can directly and quantitatively capture the meiotic DSB 3’ overhang hotspots at single-nucleotide resolution.
2023-01-08 | GSE154289 | GEO
Project description:SPO11-promoted DNA double-strand breaks (DSBs) formation is a crucial step for meiotic recombination, and it is indispensable to detect the broken DNA ends accurately for dissecting the molecular mechanisms behind. Here, we report a novel technique, named DEtail-seq (DNA End tailing followed by sequencing), that can directly and quantitatively capture the meiotic DSB 3’ overhang hotspots at single-nucleotide resolution.
2023-01-08 | GSE154227 | GEO
Project description:SPO11-promoted DNA double-strand breaks (DSBs) formation is a crucial step for meiotic recombination, and it is indispensable to detect the broken DNA ends accurately for dissecting the molecular mechanisms behind. Here, we report a novel technique, named DEtail-seq (DNA End tailing followed by sequencing), that can directly and quantitatively capture the meiotic DSB 3’ overhang hotspots at single-nucleotide resolution.
2023-01-08 | GSE154226 | GEO
Project description:This pilot study will aim to determine whether circulating tumor cells (CTCs) can be captured using the novel cMET based ferrofluid. The primary objective of this pilot study will be to describe the numbers of c-MET expressing cells that can be detected by the c-MET CTC capture technique. These data will be separated by disease site. The investigator will also describe the detection rates of both the c-MET CTC capture and the EpCAM CTC capture techniques in each patient, also separated by disease site.
| 2162178 | ecrin-mdr-crc
Project description:Targeted sequencing of genome is essential to the basic biological research and biomedicine. Therefore, various targeted enrichment methods have been developed for this end, in which various hybridization-based methods have been most widely used. However, the current hybridization-based methods (both on solid or in solution) are still restricted by the intrinsic shortcomings of nucleic acid hybridization. In this study, by combining an engineered dCas9-sgRNA with widely used magnetic isolation, we developed a new strategy to enrich target genomic DNAs in high efficiency. In this strategy, target DNA was firstly specifically recognized and bound by a complex of dCas9 and capture sgRNA (csgRNA). The DNA-dCas9-csgRNA complex was then captured on magnetic beads through the annealing of elongated 3′ end of csgRNA with single-stranded capture oligonucleotides coupled on streptavidin-coated magnetic beads. We thus named the strategy as CRISPR-assistant target enrichment (CATE). The enriched DNAs can be analyzed by the next generation sequencing (NGS). We thus named the technique as CATE-seq. Used the technique, we successfully enriched 35 target exons of 6 genes in 6 cell lines by using 54 csgRNA. We found that the target genomic DNA fragments such as exons could be efficiently enriched and analyzed by CATE-seq. The technique has several significant advantages over the current hybridization-based methods, including high simplicity, specificity, sensitivity, and throughput. This study therefore provides a new powerful tool for targeted sequencing.
2018-09-15 | GSE119994 | GEO
Project description:We used the technology of MNase-seq and capture-based target enrichment to analyze nucleosome positioning on the HIV DNA.
2020-03-02 | GSE139556 | GEO
Project description:We used the technology of MNase-seq and capture-based target enrichment to analyze nucleosome positioning on the HIV DNA.
2020-03-02 | GSE135551 | GEO
Project description:Transcriptomic analyses have revealed an unexpected complexity of the human transcriptome, whose breadth and depth exceeds current RNA sequencing capacity 1-3. Here we combine tiling arrays and RNA sequencing technologies, in an approach we term RNA Capture-Seq, to enable the assembly and characterisation of transcripts whose expression level is below the detection limits of conventional sequencing approaches. By this technique we identify novel exons and splicing patterns to even well-studied genes, such as the p53 and Hox loci, and expose widespread, regulated and remarkably complex noncoding transcription in intergenic regions. We show that unassigned tags observed in conventional RNA sequencing datasets are not noise but can derive from rare transcripts fully assembled by RNA Capture-Seq. We expect RNA Capture-Seq to prove an invaluable technique for future research into gene expression and its relationship to phenotypic variation. Application of RNA Capture sequencing from human fibroblasts for identifying rare novel transcripts. Hybridization enhancing oligos are designed to cover the full sequencing adaptor and MID sequences during hybridisation. Enhancing Oligo A 5 CCATCTCATCCCTGCGTGTCTCCGACTCAG/3ddc/ Enhancing Oligo B 5' CCTATCCCCTGTGTGCCTTGGCAGTCTCAG/3ddc/
2011-09-12 | E-GEOD-29040 | biostudies-arrayexpress
Project description:Transcriptomic analyses have revealed an unexpected complexity of the human transcriptome, whose breadth and depth exceeds current RNA sequencing capacity 1-3. Here we combine tiling arrays and RNA sequencing technologies, in an approach we term RNA Capture-Seq, to enable the assembly and characterisation of transcripts whose expression level is below the detection limits of conventional sequencing approaches. By this technique we identify novel exons and splicing patterns to even well-studied genes, such as the p53 and Hox loci, and expose widespread, regulated and remarkably complex noncoding transcription in intergenic gene deserts. We show that unassigned tags observed in conventional RNA sequencing datasets are not noise but can derive from rare transcripts fully assembled by RNA Capture-Seq. We expect RNA Capture-Seq to prove an invaluable technique for future research into gene expression and its relationship to phenotypic variation. Application of RNA Capture sequencing from human fibroblasts for identifying rare novel transcripts. Hybridization enhancing oligos are designed to cover the full sequencing adaptor and MID sequences during hybridisation. Enhancing Oligo A 5 CCATCTCATCCCTGCGTGTCTCCGACTCAG/3ddc/ Enhancing Oligo B 5' CCTATCCCCTGTGTGCCTTGGCAGTCTCAG/3ddc/
2011-09-12 | E-GEOD-29038 | biostudies-arrayexpress