Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro.
Project description:To better examine the molecular mechanisms behind the virus infection, we conducted a correlation analysis of RNA-Seq and quantitative iTRAQ-LC-MS/MS in TuMV-infected and in healthy Chinese cabbage leaves.
Project description:Arabidopsis ecotype Col-0 expressing RPL18 fused to His & Flag epitopes (RPL18-HF) under 35S control was used to discern the effects of Turnip mosaic virus (TuMV) infection on host translation initiation. Plants were grown in LC-1 soil in 12 hour days and infected by TuMV-GFP or mock-inoculated just prior to sending up bolts. Samples were taken from rosette leaves 10 days after inoculation. Only tissue fluorescing GFP was selected from the virus-infected samples. Similar tissue was sampled from mock-infected leaves. FLAG antibody was used to isolate RPL18-HF. The RNA co-immunoprecipitated with RPL18-HF is fully translation-initiated. This translation-initiated RNA, also referred to as polysomal RNA, was isolated and compared to total RNA under both mock and TuMV-infected states to find TuMV-induced changes in host translation initiation. ****[PLEXdb(http://www.plexdb.org) has submitted this series at GEO on behalf of the original contributor, Jackson Moeller. The equivalent experiment is AT42 at PLEXdb.]
Project description:At 7 and 10 dpi with wild type TuMV or buffer (mock) whole plants (root not included) were collected and total RNA extracted for sRNA sequencing using the Illumina plataform.
Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.
Project description:Using 3' RACE-seq method, we analyzed the impact of URT1 and/or HESO1 inactivation on the uridylation of GFLV, TuMV and TCV RNAs in Arabidopsis.
Project description:Arabidopsis ecotype Col-0 expressing RPL18 fused to His & Flag epitopes (RPL18-HF) under 35S control was used to discern the effects of Turnip mosaic virus (TuMV) infection on host translation initiation. Plants were grown in LC-1 soil in 12 hour days and infected by TuMV-GFP or mock-inoculated just prior to sending up bolts. Samples were taken from rosette leaves 10 days after inoculation. Only tissue fluorescing GFP was selected from the virus-infected samples. Similar tissue was sampled from mock-infected leaves. FLAG antibody was used to isolate RPL18-HF. The RNA co-immunoprecipitated with RPL18-HF is fully translation-initiated. This translation-initiated RNA, also referred to as polysomal RNA, was isolated and compared to total RNA under both mock and TuMV-infected states to find TuMV-induced changes in host translation initiation. ****[PLEXdb(http://www.plexdb.org) has submitted this series at GEO on behalf of the original contributor, Jackson Moeller. The equivalent experiment is AT42 at PLEXdb.] pathogen infection: TuMV inoculated - RNA fraction: polysomal RNA(3-replications); pathogen infection: TuMV inoculated - RNA fraction: total RNA(3-replications); pathogen infection: mock inoculated - RNA fraction: polysomal RNA(3-replications); pathogen infection: mock inoculated - RNA fraction: total RNA(3-replications)
Project description:This model was reconstructed from single-nucleus RNA-seq (snRNA-seq) data of human postmortem brain and curated using published metabolomics data from human iPSC-derived neurons and cerebrospinal fluid (CSF), together with gene expression data from the Human Protein Atlas. It more accurately simulates human neuronal metabolic flux in neurodegenerative conditions such as Alzheimer's disease (AD).
Project description:Individual miRNA profile was identified for two Col-0 WT replicates and two Col-0 TuMV infected plant replicate samples, with 12-15 plants in each replicate.Comparison was done based on the microRNA expression profile in both biological replicates for infected and uninfected plant samples .