Nicotinamide regulates LPS-induced HIF-1alpha responses through post-translational modifications in human macrophages
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA777918 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Mechanisms to control the immune response are important to pathogen evasion and host defense. Gram-negative bacteria are common pathogens that can activate host immune responses through their outer membrane component, lipopolysaccharide (LPS). Macrophages activated by LPS induce cell signals that promote hypoxic metabolism, phagocytosis, and antigen presentation. Nicotinamide (NAM) is a vitamin B3 derivative and precursor in the formation of nicotinamide adenine dinucleotide (NAD), which is a required co-factor in cellular function. In this study, treatment of human monocyte derived macrophages with NAM antagonized LPS-induced responses by altering the expression of ubiquitin genes, increasing HIF-1alpha and p65/RelA ubiquitination, decreasing p65/RelA acetylation and promoting the formation of the proteasome. NAM also elevated intracellular NAD levels and altered the genetic expression of sirtuins and poly(ADP-ribose) polymerases. These NAM responses highlight post-translational events in regulating the host response to pathogens and identify the ubiquitome as a target in pathogen evasion and host defense.
2023-05-01 | GSE188206 | GEO
Project description:Intestinal epithelia exist in a uniquely dynamic oxygen tension microenvironment. Adaptive responses to hypoxia in mammalian cells are regulated largely by hypoxia inducible factor (HIF) transcriptional complexes. Functional HIF exists as an obligate alpha/beta heterodimer, comprising both a constitutive subunit (HIF-1beta), and an oxygen-labile regulatory (alpha) component. To date, three regulatory subunits have been identified, namely HIF-1alpha, HIF-2alpha, and HIF-3alpha, with the highest level of sequence homology conserved between HIF-1alpha and HIF-2alpha. Despite their concurrent expression in intestinal epithelial cells, HIF-1 and HIF-2 play non-redundant roles in the regulation of an overlapping but distinct set of gene targets. In this study, we performed ChIP-on-chip analysis of chromatin isolated from hypoxic intestinal epithelia to delineate HIF-1 and HIF-2 specific loci. Comparison of HIF-1alpha ChIP-chip and HIF-2alpha ChIP-chip to map HIF-1- and HIF-2-specific gene targets across the genome.
2013-11-05 | E-GEOD-43108 | biostudies-arrayexpress
Project description:An oxygen stable form of HIF-1alpha was overexpressed in the hearts of mice, under tet-off control. Bi-allelic transgenic mice were created by crossing alpha-MHC promoter/tet transactivating protein expressing mice with tet responsive element promter/stable HIF-1alpha protein expressing mice. Mice were either, maintained on Doxycycline (inhibiting the expression of the HIF-1alpha transgene) or removed from doxycycline (inducing expression) for one or three days.
2010-05-15 | E-GEOD-12673 | biostudies-arrayexpress
Project description:Intestinal epithelia exist in a uniquely dynamic oxygen tension microenvironment. Adaptive responses to hypoxia in mammalian cells are regulated largely by hypoxia inducible factor (HIF) transcriptional complexes. Functional HIF exists as an obligate alpha/beta heterodimer, comprising both a constitutive subunit (HIF-1beta), and an oxygen-labile regulatory (alpha) component. To date, three regulatory subunits have been identified, namely HIF-1alpha, HIF-2alpha, and HIF-3alpha, with the highest level of sequence homology conserved between HIF-1alpha and HIF-2alpha. Despite their concurrent expression in intestinal epithelial cells, HIF-1 and HIF-2 play non-redundant roles in the regulation of an overlapping but distinct set of gene targets. In this study, we performed ChIP-on-chip analysis of chromatin isolated from hypoxic intestinal epithelia to delineate HIF-1 and HIF-2 specific loci.
2013-11-05 | GSE43108 | GEO
Project description:We reported that HAUSP (USP7) deubiquitinase interacts with and deubiquitinates HIF-1α to increase its stability and functions. HAUSP, HIF-1alpha and CBP could form a complex to regulate histone modification and gene transcription
2016-01-13 | GSE76770 | GEO
Project description:An oxygen stable form of HIF-1alpha was overexpressed in the hearts of mice, under tet-off control.
2008-12-02 | GSE12673 | GEO
Project description:This report explores the effect of Hif-1alpha deletion, using a conditional mouse model, together with standard chemotherapy regimen to evaluate leukemia stem cell (LSC) targeting in a murine model of MLL-AF9 driven acute myeloid leukemia (AML). This study reveals that Hif-1alpha-deleted leukemias displayed a faster disease progression after chemotherapy.
2019-01-23 | GSE119484 | GEO
Project description:To explore in vivo changes in gene expression of osteosarcoma cells upon depletion of HIF-1alpha we performed RNAseq analysis using Mock control AXT cells and HIF-1alpha KO AXT cells. HIF1alpha was knocked out using CRISPR-Cas9 with two different target sequences. KO1-1 and KO1-2 cells are derived from target sequence#1:5’- AGATGTGAGCTCACATTGTGGGG -3’ (exon3) and KO2 cells are from #2:5’-GCTAACAGATGACGGCGACATGG-3’ (exon5). AXT cells were established from BMSCs of Ink4a/Arf null mouse by overexpressing human c-MYC (Shimizu T, et al. Oncogene, 2010).
2026-01-04 | GSE307480 | GEO
Project description:Hypoxia is closely linked to chemotherapy resistance and accelerates breast cancer progression. However, the underlying mechanism of resistance to hypoxic chemotherapy remains uncertain. ZNF207 was identified as a differentially expressed gene involved in hypoxia and chemotherapy resistance by RNA-sequencing array. ZNF207 expression was elevated in lung, breast, liver, colon, and ovarian cancers, and its positive expression was correlated significantly with advanced TNM stage, lymph node metastasis, and poor prognosis. ZNF207 overexpression promoted the proliferation, invasion capabilities, and stemness of breast cancer cells by activating the HIF-1alpha-PPAR-gamma-glycolysis signaling pathway. Notably, ZNF207 was directly bound to the coiled-coil domain of YWHAZ, thereby accelerating HIF-1alpha deacetylation in an HDAC4-dependent manner. Furthermore, ZNF207 might stabilize YWHAZ by inhibiting its degradation via TRIM67 through a ubiquitin-dependent mechanism. ZNF207 overexpression enhanced resistance to doxorubicin and vinorelbine. Conversely, ZNF207-DeltaGLE overexpression disrupted HIF-1alpha-PPAR-gamma-glycolysis signaling and abolished chemotherapy resistance. Additionally, ZNF207 expression was higher in patients with breast cancer who exhibited poor treatment outcomes (Miller/Payne grades 1-2) than in those with more favorable outcomes (Miller/Payne grades 3-5). Sappanchalcone, a specific ZNF207 inhibitor, impedes breast cancer progression while exerting a synergistic effect with chemotherapy. Our findings revealed that ZNF207 expression was elevated in breast cancer under hypoxic conditions, promoting proliferation and invasion by activating HIF-1alpha through accelerated deacetylation in a positive feedback loop. The interaction between ZNF207 and YWHAZ enhances HIF-1alpha stability, ultimately accelerating therapeutic resistance in breast cancer.
2024-10-16 | GSE279294 | GEO
Project description:Hypoxia is closely linked to chemotherapy resistance and accelerates breast cancer progression. However, the underlying mechanism of resistance to hypoxic chemotherapy remains uncertain. ZNF207 was identified as a differentially expressed gene involved in hypoxia and chemotherapy resistance by RNA-sequencing array. ZNF207 expression was elevated in lung, breast, liver, colon, and ovarian cancers, and its positive expression was correlated significantly with advanced TNM stage, lymph node metastasis, and poor prognosis. ZNF207 overexpression promoted the proliferation, invasion capabilities, and stemness of breast cancer cells by activating the HIF-1alpha-PPAR-gamma-glycolysis signaling pathway. Notably, ZNF207 was directly bound to the coiled-coil domain of YWHAZ, thereby accelerating HIF-1alpha deacetylation in an HDAC4-dependent manner. Furthermore, ZNF207 might stabilize YWHAZ by inhibiting its degradation via TRIM67 through a ubiquitin-dependent mechanism. ZNF207 overexpression enhanced resistance to doxorubicin and vinorelbine. Conversely, ZNF207-DeltaGLE overexpression disrupted HIF-1alpha-PPAR-gamma-glycolysis signaling and abolished chemotherapy resistance. Additionally, ZNF207 expression was higher in patients with breast cancer who exhibited poor treatment outcomes (Miller/Payne grades 1-2) than in those with more favorable outcomes (Miller/Payne grades 3-5). Sappanchalcone, a specific ZNF207 inhibitor, impedes breast cancer progression while exerting a synergistic effect with chemotherapy. Our findings revealed that ZNF207 expression was elevated in breast cancer under hypoxic conditions, promoting proliferation and invasion by activating HIF-1alpha through accelerated deacetylation in a positive feedback loop. The interaction between ZNF207 and YWHAZ enhances HIF-1alpha stability, ultimately accelerating therapeutic resistance in breast cancer.
2024-10-21 | GSE279443 | GEO