Project description:We compared the microbiota of paired mouse caecal contents and faeces by applying a multi-omic approach, including 16S rDNA sequencing, shotgun metagenomics, and shotgun metaproteomics. The aim of the study was to verify whether faecal samples are a reliable proxy for the mouse colonic luminal microbiota, as well as to identify changes in taxonomy and functional activity between caecal and faecal microbial communities, which have to be carefully considered when using stool as sample for mouse gut microbiota investigations.
Project description:This study aimed to analyze changes in gut microbiota composition in mice after transplantation of fecal microbiota (FMT, N = 6) from the feces of NSCLC patients by analyzing fecal content using 16S rRNA sequencing, 10 days after transplantation. Specific-pathogen-free (SPF) mice were used for each experiments (N=4) as controls.
Project description:Parkinson's disease (PD) is a common neurodegenerative disease in middle-aged and elderly people. The disorder of gut microbiota is involved in the pathophysiological process of various neurological diseases, and many studies have confirmed that gut microbiota is involved in the progression of PD. As one of the most effective methods to reconstruct gut microbiota, fecal microbiota transplantation (FMT) has been considered as an important treatment for PD. However, the mechanism of FMT treatment for PD is still lacking, which requires further exploration and can facilitate the application of FMT. As a model organism, Drosophila is highly conserved with mammalian system in maintaining intestinal homeostasis. In this study, there were significant differences in the gut microbiota of conventional Drosophila colonized from PD patients compared to those transplanted from normal controls. And we constructed rotenone-induced PD model in Drosophila followed by FMT in different groups, and investigated the impact of gut microbiome on transcriptome of the PD host. Microbial analysis by 16S rDNA sequencing showed that gut microbiota could affect bacterial structure of PD, which was confirmed by bacterial colonization results. In addition, transcriptome data suggested that gut microbiota can influence gene expression pattern of PD. Further experimental validations confirmed that lysosome and neuroactive ligand-receptor interaction are the most significantly influenced functional pathways by PD-derived gut microbiota. In summary, our data reveals the influence of PD-derived gut microbiota on host transcriptome and helps better understanding the interaction between gut microbiota and PD through gut-brain axis. The present study will facilitate the understanding of the mechanism underlying PD treatment with FMT in clinical practice.
2023-01-13 | GSE221760 | GEO
Project description:16S rDNA sequencing of gut microbiota in diabetic patients
Project description:To compare the similarities and differences in species diversity of the gut microbiota between the patients with melasma and healthy subjects. The feces were collected for 16S rRNA sequencing analysis of the gut microbiota.
Project description:In this study, we performed a comparative analysis of gut microbiota composition and gut microbiome-derived bacterial extracellular vesicles (bEVs) isolated from patients with solid tumours and healthy controls. After isolating bEVs from the faeces of solid tumour patients and healthy controls, we performed spectrometry analysis of their proteomes and next-generation sequencing (NGS) of the 16S gene. We also investigated the gut microbiomes of faeces from patientsand controls using 16S rRNA sequencing. Machine learning was used to classify the samples into patients and controls based on their bEVs and faecal microbiomes.
Project description:The aim of this project was to explore the role of gut microbiota in the development of small intestine. The gut microbiota from different groups was used to treat the mice for 1 or 2 weeks. Then the small intestine samples were collected. The RNA was used for the RNA-seq analysis to search the role of gut microbiota in the development of small intestine. Groups: IMA100 mean gut microbiota from Alginate oligosaccharide 100mg/kg treated mice; IMA10 mean gut microbiota from Alginate oligosaccharide 10mg/kg treated mice; IMC mean gut microbiota from control group mice (dosed with water); Sa mean dosed with saline (no gut microbiota). "1" mean dosed for 1 week, "2" means dosed for 2 weeks.
Project description:v3-v4 16S rRNA sequencing was used to characterize both gut and oral microbiota composition of RCC (refractory chronic cough) patients and matched healthy controls (HC). The groups are matched in age and gender.
Project description:To address the role of gut microbiota in the development of paclitaxel-induced peripheral neuropathy (PIPN), we performed 16S rRNA sequencing analysis of feces samples at 14 days and 28 days after the initiation of paclitaxel or vehicle injections.
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.
