Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: 16S Amplicon sequencing of tobacco field soil samples

PROVIDER: PRJNA814864 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR18307814_1.fastq.gz	Fastqsanger.gz
	SRR18307814_2.fastq.gz	Fastqsanger.gz
	SRR18307815_1.fastq.gz	Fastqsanger.gz
	SRR18307815_2.fastq.gz	Fastqsanger.gz
	SRR18307816_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 68

Similar Datasets

Project description:ITS Amplicon sequencing of tobacco field soil samples

| PRJNA814872 | ENA

Experimental tests strongly challenge the evidence of a healthy human blood microbiome

Project description:The study critically evaluate the results of 16S targeted amplicon sequencing performed on the total DNA collected from healthy donors’ blood samples in the light of specific negative controls.

2024-03-01 | GSE254843 | GEO

Project description:16s amplicon sequencing of soil samples

| PRJNA1253922 | ENA

16s Amplicon sequencing of soil samples from sorghum field

Project description:Amplicon sequencing of soil samples from sorghum field

| PRJEB15133 | ENA

Cover crop monocultures and mixtures improve the rhizosphere bacterial abundance and functionality through root channel re-use

Project description:Cover cropping is an effective method to protect agricultural soils from erosion, promote nutrient and moisture retention, encourage beneficial microbial activity, and maintain soil structure. Reusing winter cover crop root channels with the maize roots during the summer allows the cash crop to extract resources from farther niches in the soil horizon. In this study, we investigate how reusing winter cover crop root channels to grow maize (Zea mays L.) affects the composition and function of the bacterial communities in the rhizosphere using 16S rRNA gene amplicon sequencing and metaproteomics. We discovered that the bacterial community significantly differed among cover crop variations, soil profile depths, and maize growth stages. Re-usage of the root channels increased bacterial abundance, and it further increases as we elevate the complexity from monocultures to mixtures. Upon mixing legumes with brassicas and grasses, the overall expression of several steps of the carbon cycle (C) and the nitrogen cycle (N) improved. The deeper root channels of legumes and brassicas compared to grasses correlated with higher bacterial 16S rRNA gene copy numbers and community roles in the respective variations in the subsoil regimes due to the increased availability of root exudates secreted by maize roots. In conclusion, root channel re-use (monocultures and mixtures) improved the expression of metabolic pathways of the important C and N cycles, and the bacterial communities, which is beneficial to the soil rhizosphere as well as to the growing crops.

2025-05-02 | PXD046832 | Pride

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Microbial diversity of an uncontaminated and a 2,4,6-TNT contaminated soil sample with CodeLink microarrays

Project description:Comparison of probe-target dissociations of probe Eub338 and Gam42a with native RNA of P. putida, in vitro transcribed 16s rRNA of P. putida, in vitro transcribed 16S rRNA of a 2,4,6-trinitrotoluene contaminated soil and an uncontaminated soil sample. Functional ANOVA revealed no significant differences in the dissociation curves of probe Eub338 when hybridised to the different samples. On the opposite, the dissociation curve of probe Gam42a with native RNA of P. putida was significantly different than the dissociation curves obtained with in vitro transcribed 16S rRNA samples. Keywords: Microbial diversity, thermal dissociation analysis, CodeLink microarray

2005-11-05 | GSE3525 | GEO

Project description:16S Amplicon Sequencing of Peanut Soil Samples

| PRJNA956478 | ENA

Project description:16S amplicon sequenced samples from Nash's Field Survey 2013

| PRJNA1152936 | ENA

soil metagenome

Project description:Amplicon-seq data from cultivation field soil samples

| PRJDB11935 | ENA