Project description:Purpose: The goal of this study is to compare endothelial small RNA transcriptome to identify the target of OASL under basal or stimulated conditions by utilizing miRNA-seq. Methods: Endothelial miRNA profilies of siCTL or siOASL transfected HUVECs were generated by illumina sequencing method, in duplicate. After sequencing, the raw sequence reads are filtered based on quality. The adapter sequences are also trimmed off the raw sequence reads. rRNA removed reads are sequentially aligned to reference genome (GRCh38) and miRNA prediction is performed by miRDeep2. Results: We identified known miRNA in species (miRDeep2) in the HUVECs transfected with siCTL or siOASL. The expression profile of mature miRNA is used to analyze differentially expressed miRNA(DE miRNA). Conclusions: Our study represents the first analysis of endothelial miRNA profiles affected by OASL knockdown with biologic replicates.
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.
Project description:A cDNA library was constructed by Novogene (CA, USA) using a Small RNA Sample Pre Kit, and Illumina sequencing was conducted according to company workflow, using 20 million reads. Raw data were filtered for quality as determined by reads with a quality score > 5, reads containing N < 10%, no 5' primer contaminants, and reads with a 3' primer and insert tag. The 3' primer sequence was trimmed and reads with a poly A/T/G/C were removed
Project description:Analysis of microbial community composition in arctic tundra and boreal forest soils using serial analysis of ribosomal sequence tags (SARST). Keywords: other
Project description:An increasing body of evidence suggests an important role of the human microbiome in health and disease. We propose a ‘lost and found’ pipeline, which examines high quality unmapped sequence reads for microbial taxonomic classification. Using this pipeline, we are able to detect bacterial and archaeal phyla in blood using RNA sequencing (RNA-Seq) data. Careful analyses, including the use of positive and negative control datasets, suggest that these detected phyla represent true microbial communities in whole blood and are not due to contaminants. We applied our pipeline to study the composition of microbial communities present in blood across 192 individuals from four subject groups: schizophrenia (n=48), amyotrophic lateral sclerosis (n=47), bipolar disorder (n=48) and healthy controls (n=49). We observe a significantly increased microbial diversity in schizophrenia compared to the three other groups and replicate this finding in an independent schizophrenia case-control study. Our results demonstrate the potential use of total RNA to study microbes that inhabit the human body.