Project description:We performed shRNA-mediated knockdown of PRMT5 in LNCaP cells via dox-inducible expression system. We sought to compare transcriptome with- and without PRMT5 knockdown across three biological replicates
Project description:We performed shRNA-mediated knockdown of MEP50 in LNCaP cells via dox-inducible expression system. We sought to compare transcriptome with- and without MEP50 knockdown across three biological replicates
Project description:Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes. LNCaP cells logarthmically growing in full serum was infected with three different shRNA lentiviruses. Three days after infection
Project description:Gene expression profiling of LNCaP cells following shRNA-mediated knockdown of TMEFF2 and growth in presence and absence of dihydrotestosterone