Homo sapiens
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA875267 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR21414200_1.fastq.gz | Fastqsanger.gz | |||
| SRR21414200_2.fastq.gz | Fastqsanger.gz | |||
| SRR21414300_1.fastq.gz | Fastqsanger.gz | |||
| SRR21414300_2.fastq.gz | Fastqsanger.gz | |||
| SRR21414400_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 624 |
Similar Datasets
Project description:This study investigates the RNA targets and cleavage sites of endogenous Cas9 in the food-borne pathogen Campylobacter jejuni. Direct RNA binding targets of Cas9 in C. jejuni strain NCTC11168 were determined using RIP-seq. The Cleavage sites were then predicted in the RNA targets by comparing total transcriptome data from WT and deletion (cas9, crRNA3, tracrRNA, CRISPR-tracrRNA) strains. PAMs for the CjeCas9 were enriched using the PAM-SCANR platform, which operates through a GFP reporter gene. Upon GFP (and thus functional PAM) enrichment, fluorescing cells were isolated using FACS and prepared plasmid DNA was amplified and prepared for sequencing.
2018-03-01 | GSE106849 | GEO
Project description:To study target sequence specificity, selectivity, and reaction kinetics of Streptococcus pyogenes Cas9 activity, we challenged libraries of random variant targets with purified Cas9::guide RNA complexes in vitro. Cleavage kinetics were nonlinear, with a burst of initial activity followed by slower sustained cleavage. Consistent with other recent analyses of Cas9 sequence specificity, we observe considerable (albeit incomplete) impairment of cleavage for targets mutated in the PAM sequence or in "seed" sequences matching the proximal 8 bp of the guide. A second target region requiring close homology was located at the other end of the guide::target duplex (positions 13-18 relative to the PAM). Strikingly, a subset of variants which broke homology in the intervening region consistently increased the capacity of Cas9 to cleave in extended reactions. Sequences flanking the guide+PAM region had measurable (albeit modest) effects on cleavage. Taken together, these studies provide both a basis for predicting effective cleavage targets and a basis for potential optimization of guide RNAs to yield efficiency beyond that of the simple perfect-match guides.
2014-11-14 | GSE58426 | GEO
Project description:Chromosomal rearrangements including large DNA-fragment inversions, deletions, and duplications by Cas9 with paired sgRNAs are important to investigate structural genome variations and developmental gene regulation, but little is known about the underlying mechanism. Here we report that disrupting CtIP or FANCD2, which is thought to function in NHEJ, enhances precise DNA-fragment deletion. In addition, by analyzing the inserted nucleotides at the junctions of DNA-fragment deletions, inversions, duplications, and characterizing the cleaved products, we find that Cas9 endonucleolytically cleaves the noncomplementary strand with a flexible scissile profile upstream of -3 position of the PAM site in vivo and in vitro, generating overhanged DSB ends. Moreover, we find that engineered Cas9 nucleases have distinct cleavage profiles. Finally, Cas9-mediated nucleotide insertions are nonrandom and are equal to the combined sequences upstream of both PAM sites with predicted frequencies. Thus, precise and predictable DNA-fragment editing could be achieved by perturbing DNA repair genes and using appropriate PAM configurations. These findings have important implications regarding 3D chromatin folding and enhancer insulation during gene regulation.
2018-07-26 | GSE113698 | GEO
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:Exon skipping technologies enable exclusion of targeted exons from mature mRNA transcripts, which has broad applications in molecular and cellular biology, medicine and biotechnology. Existing exon skipping techniques include antisense oligonucleotides, targetable nucleases and base editors, which, while effective for specific applications at some target exons, remain hindered by shortcomings preventing their broader implementation including transient effects in the case of oligonucleotides or limiting PAM motifs, sequence context preferences for deaminases, and undesirable cryptic splicing in the case of gene editing tools. To overcome these limitations, we created SPLICER, a toolbox of next-generation base editors consisting of near-PAMless Cas9 nickase variants fused with different deaminases for simultaneous editing of splice acceptor (SA) and splice donor (SD) sequences. Synchronized SA and SD editing not only improves exon skipping rates but also reduces aberrant outcomes such as cryptic splicing and intron retention. SPLICER enables editing of exon splice sites with high efficiency, including many exons refractory to splicing reprogramming by the native SpCas9 BEs. To demonstrate the therapeutic potential of SPLICER, we targeted APP exon 17, which contains the amino acid residues responsible for the formation of Aβ plaques in Alzheimer’s disease. SPLICER enabled precise and highly efficient exon skipping, which reduced the formation of Aβ42 peptides in vitro while inducing DNA editing and exon skipping in vivo within a humanized mouse model of Alzheimer’s disease. Overall, SPLICER is a widely applicable and highly efficient toolbox for exon skipping with broad therapeutic applications.
2023-12-10 | GSE246586 | GEO
Project description:Exon skipping technologies enable exclusion of targeted exons from mature mRNA transcripts, which has broad applications in molecular and cellular biology, medicine and biotechnology. Existing exon skipping techniques include antisense oligonucleotides, targetable nucleases and base editors, which, while effective for specific applications at some target exons, remain hindered by shortcomings preventing their broader implementation including transient effects in the case of oligonucleotides or limiting PAM motifs, sequence context preferences for deaminases, and undesirable cryptic splicing in the case of gene editing tools. To overcome these limitations, we created SPLICER, a toolbox of next-generation base editors consisting of near-PAMless Cas9 nickase variants fused with different deaminases for simultaneous editing of splice acceptor (SA) and splice donor (SD) sequences. Synchronized SA and SD editing not only improves exon skipping rates but also reduces aberrant outcomes such as cryptic splicing and intron retention. SPLICER enables editing of exon splice sites with high efficiency, including many exons refractory to splicing reprogramming by the native SpCas9 BEs. To demonstrate the therapeutic potential of SPLICER, we targeted APP exon 17, which contains the amino acid residues responsible for the formation of Aβ plaques in Alzheimer’s disease. SPLICER enabled precise and highly efficient exon skipping, which reduced the formation of Aβ42 peptides in vitro while inducing DNA editing and exon skipping in vivo within a humanized mouse model of Alzheimer’s disease. Overall, SPLICER is a widely applicable and highly efficient toolbox for exon skipping with broad therapeutic applications.
2023-12-10 | GSE246587 | GEO
Project description:To study target sequence specificity, selectivity, and reaction kinetics of Streptococcus pyogenes Cas9 activity, we challenged libraries of random variant targets with purified Cas9::guide RNA complexes in vitro. Cleavage kinetics were nonlinear, with a burst of initial activity followed by slower sustained cleavage. Consistent with other recent analyses of Cas9 sequence specificity, we observe considerable (albeit incomplete) impairment of cleavage for targets mutated in the PAM sequence or in "seed" sequences matching the proximal 8 bp of the guide. A second target region requiring close homology was located at the other end of the guide::target duplex (positions 13-18 relative to the PAM). Strikingly, a subset of variants which broke homology in the intervening region consistently increased the capacity of Cas9 to cleave in extended reactions. Sequences flanking the guide+PAM region had measurable (albeit modest) effects on cleavage. Taken together, these studies provide both a basis for predicting effective cleavage targets and a basis for potential optimization of guide RNAs to yield efficiency beyond that of the simple perfect-match guides. 118 samples anaylzed. Controls have con in sample name. To quantitatively measure cleavage efficiency of a single gRNA, we created a population of random variant target sequences to two gRNA targets. The targets used were "unc-22A", [a sequence from the well-characterized unc-22 gene of Caenorhabditis elegans], and "protospacer 4" (ps4), a previously characterized sequence from a natural spacer from S. pyogenes MGAS10750 . Using custom mixtures of oligonucleotide precursors for each base during chemical synthesis, a set of polymorphic target libraries ('Random Variant Libraries') were designed to have a baseline variation rate at each position. On each side of the gRNA homology and PAM regions, 6 bps of random sequence were added. The first base of intended gRNA homology is designated base 1 . The entire 35 bp random variant library mixture was cloned into a standard plasmid vector (pHRL-TK). Several thousand colonies from plates were washed in pools and prepared by standard plasmid preparation methods. The complexity of the libraries were estimated based on Illumina sequencing of the uncut libraries and filtering for minimum representation expected from the pooling. Approximately 1500-3000 unique species were obtained in the unc-22A libraries and 5000 unique sequences in the ps4 library (see Materials and Methods). To assay cleavage, purified Cas9 was first incubated with gRNA, followed by incubation with the variant library for various time points and under various conditions. DNA template is among the conditions varied in the experiments. After protein removal, flanking sequences outside of the target region are used for PCR amplification and plasmid cleavage was measured through loss of PCR products that span the region of interest. A set of perfectly matched targets and highly mutated versions present in the random variant library served as internal positive and negative controls respectively. A log retention score for each sequence in each experiment was calculated by quantifying the representation of each sequence before and after addition of the Cas9 protein. Two approaches were used for normalization: first we used a population of ps4 targets "spiked" into the library as an uncleaved control, second, we used a population of unc-22A targets with large numbers of variations from the perfect target (between 4 and 7), and hence likely limited if any cleavage. Equivalent results are obtained with these two normalization approaches (see Computational Methods for details). Retention scores are expressed as the log2 of the normalized ratio, so that a more negative retention score indicates efficient cleavage of substrate while a less negative score indicates less cleavage. Templates which are uncleaved will yield a retention score at or near zero. Comparisons between multiple experiments indicate strong correlation between independent retention measurements. GSM1410678-GSM1410761; AF_SOL*.dat' files contain the calculated final retentions for each experiment. Each experiment labeled: M-bM-^@M-^\AF_SOL_###_t###M-bM-^@M-^]. M-bM-^@M-^\AF_SOL_###M-bM-^@M-^] corresponds to the experiment run ID and M-bM-^@M-^\t###M-bM-^@M-^] corresponds to the incubation time of the experiment. For example AF_SOL_513_t360, corresponds to experiment 513 on the protospacer 4 guide and DNA target and the incubation time was 360 mins. The experimental conditions and ID can be found in the associated publication. GSM1544297-GSM1544332; unc*.dat file is a tab-delimited file of all considered sequences in each experiment. The names of the files and the AF_SOL_# run number can be found in the associated publication (Supplementary Materials) with the details of the conditions. Each filename starts with the type of gRNA used (either unc-22WT or the mutant version unc22C11G). The next number (#min) is indication of the time of incubation for the experiment and this is either followed by #pcr_AF_SOL_# or just AF_SOL_#. If followed by #pcr, that is the indication of the number of PCR cycles used in the experiments. Finally, AF_SOL_# denotes the sequencing run ID number.
2014-11-14 | E-GEOD-58426 | biostudies-arrayexpress
Project description:A key limitation of the commonly-used CRISPR enzyme S. pyogenes Cas9 is the strict requirement of an NGG protospacer-adjacent motif (PAM) at the target site, which reduces the number of accessible genomic loci. This constraint can be limiting for genome editing applications that require precise Cas9 positioning. Recently, two Cas9 variants with a relaxed PAM requirement (NG) have been developed (xCas9 and Cas9-NG) but their activity has been measured at only a small number of endogenous sites. Here we devised a high-throughput Cas9 pooled competition screen to compare the performance of both PAM-flexible Cas9 variants and wild-type Cas9 at thousands of genomic loci and across 3 modalities (gene knock-out, transcriptional activation and suppression). We show that PAM flexibility comes at a substantial cost of decreased DNA targeting and cutting. Of the PAM-flexible variants, we found that Cas9-NG outperforms xCas9 regardless of genome engineering modality or PAM. Finally, we combined xCas9 mutations with those of Cas9-NG, creating a stronger transcriptional modulator than existing PAM-flexible Cas9 variants.
2020-01-26 | GSE143892 | GEO
Project description:The bacterial CRISPR-Cas9 (Cas9) nuclease has become a powerful genome manipulation tool for a wide range of organisms 1-3. However, it has yet to fully leverage the pervasive presence of DNA methylation in genomes4-10. To fill this gap, we report biochemical, structural, and human genome editing characterizations of a methylation-sensitive Cas9 (ThermoCas9). ThermoCas9 efficiently binds and cleaves DNA upstream of its protospacer adjacent motif (PAM) 5´-NNNNCGA-3´ or 5´-NNNNCCA-3´ in vitro. Methylation of the fifth cytosine in either PAM sequence (5mCpG or 5mCpC), however, significantly inhibits ThermoCas9 activity. Cryogenic electron microscopy structures of ThermoCas9 in pre- and post-cleavage states at 2.8 Å and 2.2 Å resolution, respectively, reveal the molecular basis for the stringent requirement of the unmethylated cytosine in PAM binding and provides guidance for further enzyme engineering. We demonstrated methylation-sensitive editing by ThermoCas9 in human cell lines with distinct DNA methylation landscapes. Moreover, we demonstrated that a catalytically enhanced ThermoCas9 efficiently targets luminal expression signature genes that are consistently hypomethylated in breast cancer patients. Due to its sensitivity to DNA methylation, ThermoCas9 can target cells specifically with disease-related hypomethylation which adds another layer of precision to genome editing technologies.
2026-03-31 | GSE322563 | GEO