Project description:Here we report 16s rRNA data from environmental samples that include metal working fluid and air from a machine facility and lung tissue samples. Microbiota composition of environmental and lung tissue samples showed greater similarity between case samples than between control samples.
2020-09-18 | GSE87406 | GEO
Project description:16S rRNA amplicon sequencing of marine environmental samples
Project description:Purpose: This study aims to compare and analyze the differences in bacterial community composition in fecal samples from mice treated with Control(DW), Vancomycin (VAN), Ampicillin (AMP), Neomycin (NEO), Metronidazole (MET), and a combination of all antibiotics (ALL, VANM) using 16S rRNA sequencing. Methods: Each antibiotics treated mice's fecal samples were collected and stored -80'c until analyzation. DNA was extracted using the NucleoSpin DNA Stool Kit (MACHEREY-NAGEL) following the manufacturer’s protocol. Metagenomic sequencing was performed on an Illumina MiSeq platform (Illumina), targeting the V3 and V4 regions of the 16S rRNA gene according to the manufacturer's instructions. PCR products were purified using AMPure XP beads, and sequencing adapters were added using the Nextera XT Index Kit (Illumina). The library was further purified with AMPure XP beads and quantified using automated electrophoresis with the TapeStation System (Agilent). Sequencing was performed using the MiSeq v3 reagent kit (Illumina), following the manufacturer’s protocol. Results: QIIME2 (v2023.02) was used to process and analyze 16S rRNA gene amplicon sequencing data, from sequence preprocessing to taxonomic classification. Paired-end sequences were merged and quality-filtered using Deblur. The resulting amplicon sequence variants (ASVs) were used for downstream analyses. Conclusions: Our study presents a comparative analysis of bacterial community composition in fecal samples from antibiotic-treated mice. We observed that microbiota composition varied distinctly depending on the type of antibiotic administered.
Project description:In this study we developed metaproteomics based methods for quantifying taxonomic composition of microbiomes (microbial communities). We also compared metaproteomics based quantification to other quantification methods, namely metagenomics and 16S rRNA gene amplicon sequencing. The metagenomic and 16S rRNA data can be found in the European Nucleotide Archive (Study number: PRJEB19901). For the method development and comparison of the methods we analyzed three types of mock communities with all three methods. The communities contain between 28 to 32 species and strains of bacteria, archaea, eukaryotes and bacteriophage. For each community type 4 biological replicate communities were generated. All four replicates were analyzed by 16S rRNA sequencing and metaproteomics. Three replicates of each community type were analyzed with metagenomics. The "C" type communities have same cell/phage particle number for all community members (C1 to C4). The "P" type communities have the same protein content for all community members (P1 to P4). The "U" (UNEVEN) type communities cover a large range of protein amounts and cell numbers (U1 to U4). We also generated proteomic data for four pure cultures to test the specificity of the protein inference method. This data is also included in this submission.
2017-05-12 | PXD006118 | Pride
Project description:16S rRNA Amplicon Sequencing Data of Caproic Acid-Producing Enrichment Culture
| PRJNA1363000 | ENA
Project description:16S rRNA gene amplicon sequencing of various environmental samples
Project description:Mastitis, one of the most significant diseases affecting dairy cattle, is caused by diverse bacterial pathogens that elicit distinct host immune responses. To gain deeper insight into the molecular mechanisms underlying these pathogen-specific interactions, we conducted a comprehensive proteomic analysis of bovine somatic cells isolated from milk in relation to the bacterial species present. The study included 56 quarter-level samples collected from 24 dairy cows. Samples were grouped according to pathogen categories based on the taxonomic similarity derived from 16S rRNA amplicon sequencing. Proteomic profiling revealed patterns of protein expression associated with mastitis in general, as well as distinct, pathogen-dependent signatures. This dataset provides valuable insights into host-pathogen interactions in the bovine mammary gland
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.