Project description:The rhizosphere is a small region surrounding plant roots that is enriched in biochemicals from root exudates and populated with fungi, nematode, and bacteria. Interaction of rhizosphere organisms with plants is mainly promoted by exudates from the roots. Root exudates contain biochemicals that come from primary and secondary metabolisms of plants. These biochemicals attract microbes, which influence plant nutrition. The rhizosphere bacteria (microbiome) are vital to plant nutrient uptake and influence biotic and abiotic stress and pathogenesis. Pseudomonas is a genus of gammaproteobacteria known for its ubiquitous presence in natural habitats and its striking ecological, metabolic, and biochemical diversity. Within the genus, members of the Pseudomonas fluorescens group are common inhabitants of soil and plant surfaces, and certain strains function in the biological control of plant disease, protecting plants from infection by soilborne and aerial plant pathogens. The soil bacterium Pseudomonas protegens Pf-5 (also known as Pseudomonas fluorescens Pf-5) is a well-characterized biological strain, which is distinguished by its prolific production of the secondary metabolite, pyoverdine. Knowledge of the distribution of P. fluorescens secretory activity around plant roots is very important for understanding the interaction between P. fluorescens and plants and can be achieved by real time tracking of pyoverdine. To achieve the capability of real-time tracking in soil, we have used a structure-switching SELEX strategy to select high affinity ssDNA aptamers with specificity for pyoverdine over other siderophores. Two DNA aptamers were isolated, and their features compared. The aptamers were applied to a nanoporous aluminum oxide biosensor and demonstrated to successfully detect PYO-Pf5. This sensor provides a future opportunity to track the locations around plant roots of P. protegens and to monitor PYO-Pf5 production and movement through the soil.
Project description:Pyoverdines are siderophores employed by a variety of pseudomonas species to capture essential iron by which their growth is supported in many environments in which they can be harmful or helpful to coinhabiting species or the organisms that they inhabit. Of the Pseudomonas fluorescens group, the pyoverdine of each pseudomonad species is constituted of a central chromophore and a unique peptide component that is produced by nonribosomal peptide synthetases. Pyoverdine Pf5 (PYO-Pf5) is the product of pseudomonas protegens, a species that supports plant growth, particularly in soils with limiting iron. To explore the dynamics of P. protegens activity in soil, we have selected 2’ FY modified RNA aptamers that selectively recognize PYO-Pf5 with high affinities. Two 2’FY-RNA aptamers, with different base sequences, were selected that specifically bind pyoverdine-Pf5 (PYO-Pf5) over pseudobactin (PSB), a related pyoverdine, and two other siderophores, enterobactin and ornibactin. The 2’FY-RNA aptamers were shown to be G-quadruplexes by computational prediction, N-methyl mesoporphyrin IX (NMM) binding and CD spectroscopy. They were compared with their counterparts (same base sequence) in RNA and DNA for function and structure. Whereas the 2’FY-RNA and RNA forms bound PYO-Pf5 and had circular dichroism (CD) spectra typical of a G-quadruplex, the DNA forms neither bound PYO-Pf5 nor showed diagnostic NMM binding or CD spectra for G-quadruplexes. The impact of 2’ moiety in aptamers on their structure and function have been explored and results revealed that the nature of the chemical group at the 2’ position influences binding activity and structure.The aptamers will be applied to a nanoporous aluminum oxide biosensor to detect PYO-Pf5. This sensor provides a future opportunity to track the locations around plant roots of P. protegens and to monitor PYO-Pf5 production and movement through the soil.
Project description:Here, we report an ssDNA aptamer with high specificity and affinity towards Salmonella paratyphi A generated using the whole-cell SELEX process. The aptamers generated against an organism show salient features, such as higher affinity than existing antibodies, and are highly specific towards the targeted organism. Thus, the generated aptamer sequences can serve as potential biomarkers for the onsite detection of pathogens with high specificity and sensitivity. Molecular dynamics simulation was used to model the linear chain of the aptamers to a three-dimensional conformation, and the binding mechanism against DNA gyrase was established.
Project description:There is an urgent need for agents that promote health and regeneration of cells and tissues, specifically to treat diseases of the aging nervous system. Age-associated nervous system degeneration and various diseases are driven by many different biochemical stresses, often making it difficult to target any one disease cause. Our laboratory has previously identified DNA aptamers with apparent regenerative properties in murine models of multiple sclerosis by selecting aptamers that bind oligodendrocyte membrane preparations. Here, we selected from vast libraries of molecules (~1014 unique DNAs) those with the ability to bind cultured human SH-SY5Y neuroblastoma cells as a neuronal model, followed by screening for aptamers capable of eliciting biological responses, with validation of binding in differentiated SH-SY5Y, human iPSC-derived sensory neurons, and hESC derived cortical neurons. This demonstrates a proof-of-concept workflow to identify biologically active aptamers by cycles of cell selection.
Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.