Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: 16S rRNA amplicon sequence from amiodarone induced colitis mice

PROVIDER: PRJNA967636 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR24444781.fastq.gz	Fastqsanger.gz
	SRR24444782.fastq.gz	Fastqsanger.gz
	SRR24444783.fastq.gz	Fastqsanger.gz
	SRR24444784.fastq.gz	Fastqsanger.gz
	SRR24444785.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 9

Similar Datasets

Gut microbiota analysis in WT and Il17d-deficient mice treated with or without colitis

Project description:Microbiota dysbiosis has been reported to contribute to the pathogenesis of colitis, to demonstrate whether IL-17D protects against DSS-induced colitis through regulation of microflora, we performed 16S rRNA sequencing in feces from WT and Il17d-deficient mice. Our data indicate that Il17d deficiency results in microbiota dysibiosis in both steady state and DSS-induced colitis.

2021-05-20 | GSE165789 | GEO

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

be450800-80e3-4530-9c66-868491366254 - samples

Project description:Metadata for fecal 16S-V4 rRNA gene sequence data from NCT02749630 ulcerative colitis patients.

| EGAD00001008822 | EGA

Mus musculus

Project description:16S rRNA sequencing, DSS-induced colitis mice

| PRJDB16032 | ENA

Mus musculus

Project description:16S rRNA amplicon sequencing of experimental colitis-induced colorectal cancer (CRC) mice model

| PRJDB17960 | ENA

Toll-like receptor 2 deficiency exacerbates dextran sulfate sodium (DSS)-induced intestinal injury by Marinifilaceae dependent attenuating cell cycle signaling

Project description:Ulcerative colitis (UC) is an intestinal pathology characterized by chronic recurrent inflammation, which requires in-depth exploration of its mechanisms. To investigate the biological effects of TLR2 on DSS-induced intestinal inflammation in mice, we constructed the WT and TLR2-KO colitis mice model. We found TLR2-KO mice were severely susceptible to DSS-induced colitis. To determine how TLR2 exerted a protective effect in DSS-induced colitis, we compared the global gene expression profiles in the gut between WT and TLR2-KO mice by RNA-Seq. Results suggested that cell cycle pathway-related genes were significantly downregulated in gut of TLR2-KO colitis mice. 16S rRNA gene sequencing demonstrated remarkable variation in the composition of gut microbiota between WT and TLR2-KO colitis mice. Compared with WT colitis mice, the relative abundance of Marinifilaceae, Rikenellaceae, Desulfovibrionaceae, Tannerellaceae, Ruminococcaceae, Clostridia, Mycoplasmataceae were significantly higher in the gut of TLR2-KO colitis mice at family level. Moreover, we found that the relative abundance of Marinifilaceae was negatively correlated with the expression of cell cycle signaling related genes by microbiome diversity-transcriptome collaboration analysis. We came to this conclusion: TLR 2-KO exacerbated DSS-induced intestinal injury by Marinifilaceae dependent attenuating cell cycle signaling.

2025-04-01 | GSE265856 | GEO

16S rRNA sequencing of fecal samples from Atg16l1 T300A and wildtype littermate mice that were either exposed or not to mainstream cigarette smoking for 6 weeks

Project description:We found that mainstream cigarette smoking (4 cigarettes/day, 5 days/week for 2 weeks using Kentucky Research Cigarettes 3R4F) resulted in >20% decrease in the percentage of normal Paneth cell population in Atg16l1 T300A mice but showed minimal effect in wildtype littermate control mice, indicating that Atg16l1 T300A polymorphism confers sensitivity to cigarette smoking-induced Paneth cell damage. We performed 16S rRNA sequencing to identify potential microbiota changes associated with Paneth cell defect in Atg16l1 T300A mice exposed to cigarette smoking. Female mice were used at 4-5 weeks of age. Cigarette smoking was performed using smoking chamber with the dosage and schedule as described above. The fecal samples from the mice were collected for 16S rRNA sequencing analysis after completing 6 weeks of smoking.

2018-10-31 | E-MTAB-5717 | biostudies-arrayexpress

WBSCR16 Deficiency Drives Adaptive Metabolic Flexibility Via Impaired Mitochondrial 16S rRNA Maturation

Project description:Mitochondrial rRNAs play important roles in regulating mtDNA-encoded gene expression and energy metabolism subsequently. However, the proteins that regulate mitochondrial 16S rRNA processing remain poorly understood. Herein, we generated adipose-specific Wbscr16-/- mice and cells, both of which exhibited dramatic mitochondrial changes. Subsequently, WBSCR16 was identified as a 16S rRNA-binding protein essential for the cleavage of 16S rRNA-mt-tRNALeu, facilitating 16S rRNA processing and mitochondrial ribosome assembly. Additionally, WBSCR16 recruited RNase P subunit MRPP3 to nascent 16S rRNA and assisted in this specific cleavage. Furthermore, evidence showed that adipose-specific Wbscr16 ablation promotes energy wasting via lipid preference in brown adipose tissue, leading to excess energy expenditure and resistance to obesity. In contrast, overexpression of WBSCR16 upregulated 16S rRNA processing and induced a preference for glucose utilization in both transgenic mouse models and cultured cells. These findings suggest that WBSCR16 plays essential roles in mitochondrial 16S rRNA processing in mammals, and is the key mitochondrial protein to balance glucose and lipid metabolism.

2024-12-30 | GSE229693 | GEO

c3ab80c7-30b2-4784-9d5a-b4eefad8c5c9 - samples

Project description:Fecal 16S-V4 rRNA gene sequence data from NCT02749630 ulcerative colitis patients. Stool samples were collected at screening as well as on days 29, 43, 64, 85, and 134 processed for 16SV4 rRNA gene sequencing

| EGAD00001008818 | EGA

M1002 protect mice from DSS-induced colitis through regulation of HIF-1 signaling and the Gut Microbiota in DSS-Induced Colitis in Mice

Project description:Abstract. Ulcerative colitis (UC) is an intestinal disease characterized by chronic recurrent inflammation, but the underlying mechanism remains undefined and requires in-depth exploration. The aim of the present study was to investigate the biological effects of a small molecular compound M1002 of oxygen-sensing signaling pathway on dextran sulfate sodium (DSS)-induced intestinal inflammation colitis mouse models. It was found that the protective effects of M1002 on DSS-induced colitis. To determine how M1002 exerted its protective effect in DSS-induced colitis, we compared the global gene expression profiles in the gut between DSS control and M1002 treatment colitis mouse groups by RNA-Seq. The results demonstrated that HIF-1 signaling pathway-related genes were significantly upregulated in the gut of M1002 treatment colitis mice, whereas the Inflammatory bowel disease signaling pathway, the TNF signaling pathway, and Cytokines and inflammatory response signaling pathway related genes were significantly downregulated in the M1002 treatment group. 16S rRNA gene sequencing demonstrated remarkable variations in the composition of gut microbiota between DSS control and M1002 treatment colitis mice. Compared with DSS control colitis mice, the relative abundance of Eubacterium_nodatum and Halomonas in the gut microbiota was significantly increased at genus level in the gut of M1002 treatment colitis mice. Based on these findings, we tend to conclude that M1002 might alleviate DSS-induced gut injury in mice by regulation of HIF-1 signaling and up-regulating Eubacterium_nodatum and Halomonas.

2025-07-01 | GSE271173 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data