Ontology highlight
ABSTRACT:
PROVIDER: PRJNA971606 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR24571940_1.fastq.gz | Fastqsanger.gz | |||
| SRR24571940_2.fastq.gz | Fastqsanger.gz | |||
| SRR24571941_1.fastq.gz | Fastqsanger.gz | |||
| SRR24571941_2.fastq.gz | Fastqsanger.gz | |||
| SRR24571942_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 72 |
Similar Datasets
Project description:Sensitive models of climate change impacts would require a better integration of multi-omics approaches that connect the abundance and activity of microbial populations. Here, we show that climate is a fundamental driver of the protein abundance of microbial populations (metaproteomics), yet not their genomic abundance (16S rRNA gene amplicon sequencing), supporting the hypothesis that metabolic activity may be more closely linked to climate than community composition.
2022-03-01 | PXD009773 | Pride
Project description:The characterization of microbial community structure via 16S rRNA gene profiling has been greatly advanced in recent years by the application of amplicon pyrosequencing. The possibility of barcode-tagged sequencing of templates gives the opportunity to massively screen multiple samples from environmental or clinical sources for community details. However, an on-going debate questions the reproducibility and semi-quantitative rigour of pyrotag sequencing and, as in the early days of genetic community fingerprinting, pros and cons are continuously provided. In this study we investigate the reproducibility of bacterial 454 pyrotag sequencing over biological and technical replicates of natural microbiota. Moreover, via quantitatively defined template spiking to the natural community, we explore the potential for recovering specific template ratios within complex microbial communities. For this reason, we pyrotag sequenced three biological replicates of three samples, each belonging from yearly sampling campaigns of sediment from a tar oil contaminated aquifer in Düsseldorf, Germany. Furthermore, we subjected one DNA extract to replicate technical analyses as well as to increasing ratios (0, 0.2, 2 and 20%) of 16S rRNA genes from a pure culture (Aliivibrio fisheri) originally not present in the sample. Unexpectedly, taxa abundances were highly reproducible in our hands, with max standard deviation of ~3% abundance across biological and ~2% for technical replicates. Furthermore, our workflow was also capable of recovering A. fisheri amendmend ratios in reliable amounts (0, 0.29, 3.9 and 23.8%). These results highlight that pyrotag sequencing, if done and evaluated with due caution, has the potential to robustly recapture taxa template abundances within environmental microbial communities. 9 Biological and 3 technical replicates were evaluated, as well as potential to recover qPCR-defined ratios of DNA, in 454 pyrotag sequencing
2012-07-16 | E-GEOD-35631 | biostudies-arrayexpress
Project description:The characterization of microbial community structure via 16S rRNA gene profiling has been greatly advanced in recent years by the application of amplicon pyrosequencing. The possibility of barcode-tagged sequencing of templates gives the opportunity to massively screen multiple samples from environmental or clinical sources for community details. However, an on-going debate questions the reproducibility and semi-quantitative rigour of pyrotag sequencing and, as in the early days of genetic community fingerprinting, pros and cons are continuously provided. In this study we investigate the reproducibility of bacterial 454 pyrotag sequencing over biological and technical replicates of natural microbiota. Moreover, via quantitatively defined template spiking to the natural community, we explore the potential for recovering specific template ratios within complex microbial communities. For this reason, we pyrotag sequenced three biological replicates of three samples, each belonging from yearly sampling campaigns of sediment from a tar oil contaminated aquifer in Düsseldorf, Germany. Furthermore, we subjected one DNA extract to replicate technical analyses as well as to increasing ratios (0, 0.2, 2 and 20%) of 16S rRNA genes from a pure culture (Aliivibrio fisheri) originally not present in the sample. Unexpectedly, taxa abundances were highly reproducible in our hands, with max standard deviation of ~3% abundance across biological and ~2% for technical replicates. Furthermore, our workflow was also capable of recovering A. fisheri amendmend ratios in reliable amounts (0, 0.29, 3.9 and 23.8%). These results highlight that pyrotag sequencing, if done and evaluated with due caution, has the potential to robustly recapture taxa template abundances within environmental microbial communities.
2012-07-16 | GSE35631 | GEO
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:In this study we developed metaproteomics based methods for quantifying taxonomic composition of microbiomes (microbial communities). We also compared metaproteomics based quantification to other quantification methods, namely metagenomics and 16S rRNA gene amplicon sequencing. The metagenomic and 16S rRNA data can be found in the European Nucleotide Archive (Study number: PRJEB19901). For the method development and comparison of the methods we analyzed three types of mock communities with all three methods. The communities contain between 28 to 32 species and strains of bacteria, archaea, eukaryotes and bacteriophage. For each community type 4 biological replicate communities were generated. All four replicates were analyzed by 16S rRNA sequencing and metaproteomics. Three replicates of each community type were analyzed with metagenomics. The "C" type communities have same cell/phage particle number for all community members (C1 to C4). The "P" type communities have the same protein content for all community members (P1 to P4). The "U" (UNEVEN) type communities cover a large range of protein amounts and cell numbers (U1 to U4). We also generated proteomic data for four pure cultures to test the specificity of the protein inference method. This data is also included in this submission.
2017-05-12 | PXD006118 | Pride
Project description:The study critically evaluate the results of 16S targeted amplicon sequencing performed on the total DNA collected from healthy donors’ blood samples in the light of specific negative controls.
2024-03-01 | GSE254843 | GEO
Project description:The association between soil microbes and plant roots is present in all natural and agricultural environments. Microbes can be beneficial, pathogenic, or neutral to the host plant development and adaptation to abiotic or biotic stresses. Progress in investigating the functions and changes in microbial communities in diverse environments have been rapidly developing in recent years, but the changes in root function is still largely understudied. The aim of this study was to determine how soil bacteria influence maize root transcription and microRNAs (miRNAs) populations in a controlled inoculation of known microbes over a defined time course. At each time point after inoculation of the maize inbred line B73 with ten bacterial isolates, DNA and RNA were isolated from roots. The V4 region of the 16S rRNA gene was amplified from the DNA and sequenced with the Illumina MiSeq platform. Amplicon sequencing of the 16S rRNA gene indicated that most of the microbes successfully colonized maize roots. The colonization was dynamic over time and varied with the specific bacterial isolate. Small RNA sequencing and mRNA-Seq was done to capture changes in the root transcriptome from 0.5 to 480 hours after inoculation. The transcriptome and small RNA analyses revealed epigenetic and transcriptional changes in roots due to the microbial inoculation. This research provides the foundational data needed to understand how plant roots interact with bacterial partners and will be used to develop predictive models for root response to bacteria.
2023-05-01 | GSE214656 | GEO
Project description:In this paper, we first report that EC smoking significantly increases the odds of gingival inflammation. Then, we seek to identify and explain the mechanism that underlies the relationship between EC smoking and gingival inflammation via the oral microbiome. We performed mediation analyses to assess if EC smoking affects the oral microbiome, which in turn affects gingival inflammation. For this, we collected saliva and subgingival samples from EC users and non-users and profiled their microbial compositions via 16S rRNA amplicon sequencing. We then performed α-diversity, β-diversity, and taxonomic differential analyses to survey the disparity in microbial composition between EC users and non-users. We found significant increases in α-diversity in EC users and disparities in β-diversity between EC users and non-users.
2022-12-09 | GSE201949 | GEO
Project description:Microbial ecology of redoxclines in cenotes on the Yucatan Peninsula
| PRJNA784917 | ENA
Project description:Despite the global importance of forests, it is virtually unknown how their soil microbial communities adapt at the phylogenetic and functional level to long term metal pollution. Studying twelve sites located along two distinct gradients of metal pollution in Southern Poland revealed that both community composition (via MiSeq Illumina sequencing of 16S rRNA genes) and functional gene potential (using GeoChip 4.2) were highly similar across the gradients despite drastically diverging metal contamination levels. Metal pollution level significantly impacted microbial community structure (p = 0.037), but not bacterial taxon richness. Metal pollution altered the relative abundance of specific bacterial taxa, including Acidobacteria, Actinobacteria, Bacteroidetes, Chloroflexi, Firmicutes, Planctomycetes and Proteobacteria. Also, a group of metal resistance genes showed significant correlations with metal concentrations in soil, although no clear impact of metal pollution levels on overall functional diversity and structure of microbial communities was observed. While screens of phylogenetic marker genes, such as 16S rRNA, provided only limited insight into resilience mechanisms, analysis of specific functional genes, e.g. involved in metal resistance, appeared to be a more promising strategy. This study showed that the effect of metal pollution on soil microbial communities was not straightforward, but could be filtered out from natural variation and habitat factors by multivariate statistical analysis and spatial sampling involving separate pollution gradients.
2014-07-22 | GSE59620 | GEO