Sort   by:  
 Page size 
UnknownNovel genes encoding six kinds of three-finger toxins in Ophiophagus hannah (king cobra) and function characterization of two recombinant long-chain neurotoxins.
Not available
S-EPMC1550305 | biostudies-literature
MetabolomicsChanges in lipid profiles of epileptic mouse model

INTRODUCTION: Approximately 1% of the world's population is impacted by epilepsy, a chronic neurological disorder characterized by seizures. One-third of epileptic patients are resistant to AEDs, or have medically refractory epilepsy (MRE). One non-invasive treatment that exists...

2022-01-06 | MTBLS1432 | MetaboLights
TranscriptomicssmRNA under high osmotic stress
To identifiy osmotic stress responsive smRNAs, we used a deep-sequencing technique to profile small RNA populations in leaf and root tissues of plants under high osmotic stress and control conditions. We treated 30day-old plants with high osmotic stress and sampled leaves and roots from the same pla...
ORGANISM(S): Arabidopsis thaliana 
2012-09-19 | E-GEOD-36560 | biostudies-arrayexpress
TranscriptomicsThe response and recovery of Arabidopsis thaliana transcriptome to phosphate starvation [At35b_MR]
Background: Over application of phosphate fertilizers in modern agriculture contaminates waterways and disrupts natural ecosystems. Nevertheless, this is a common practice among farmers, especially in developing countries as abundant fertilizers are believed to boost crop yields. The study of plant ...
ORGANISM(S): Arabidopsis thaliana 
2012-06-17 | E-GEOD-33996 | biostudies-arrayexpress
TranscriptomicsThe response and recovery of Arabidopsis thaliana transcriptome to phosphate starvation [ATH1-121501]
Background: Over application of phosphate fertilizers in modern agriculture contaminates waterways and disrupts natural ecosystems. Nevertheless, this is a common practice among farmers, especially in developing countries as abundant fertilizers are believed to boost crop yields. The study of plant ...
ORGANISM(S): Arabidopsis thaliana 
2012-06-17 | E-GEOD-33790 | biostudies-arrayexpress
TranscriptomicsThe response and recovery of Arabidopsis thaliana transcriptome to phosphate starvation
This SuperSeries is composed of the following subset Series: GSE33790: The response and recovery of Arabidopsis thaliana transcriptome to phosphate starvation [ATH1-121501] GSE33996: The response and recovery of Arabidopsis thaliana transcriptome to phosphate starvation [At35b_MR] Refer to individua...
ORGANISM(S): Arabidopsis thaliana 
2012-06-17 | E-GEOD-34004 | biostudies-arrayexpress
GenomicsSingle-cell analyses of regulatory network perturbations using enhancer-targeting TALEs suggest novel roles for PU.1 during haematopoietic specification
The aim of this study was to determine the genomic binding sites of an HA-tagged Transcription Activator-Like Effector (TALE) fused to a VP64 domain with a DNA binding domain designed to bind the sequence GGGCGCTTCCTGTTTTCTCA (found in the PU.1-14kb enhancer element in mouse and human genome), terme...
ORGANISM(S): Mus musculus 
2014-11-05 | E-GEOD-61189 | biostudies-arrayexpress
ProteomicsUsing isotopically labeled calibrants to quantify Heparan sulfate
This dataset contains the all the mass spectral data related to this research.
ORGANISM(S): Quantification Analysis Of Hs Using Lc-msms 
2020-06-11 | MSV000085577 | MassIVE
TranscriptomicsTranscriptome Profiling of Roots and leaves Under High Osmotic Stress in Arabidopsis
The functions of miRNAs and their target mRNAs in Arabidopsis development have been widely documented, however, roles of stress responsive miRNAs and their targets are not as well understood. Using small RNA deep sequencing and ATH1 microarrays to profile mRNAs, we identified IAR3 (IAA-Ala Resistant...
ORGANISM(S): Arabidopsis thaliana 
2012-09-19 | E-GEOD-36789 | biostudies-arrayexpress
UnknownAvailability of Advanced Practice Providers in Adult Intensive Care Units in the United States: A Survey.
Not available
S-EPMC12716625 | biostudies-literature
Sort   by:  
 Page size