The aim of this study was to determine the genomic binding sites of an HA-tagged Transcription Activator-Like Effector (TALE) fused to a VP64 domain with a DNA binding domain designed to bind the sequence GGGCGCTTCCTGTTTTCTCA (found in the PU.1-14kb enhancer element in mouse and human genome), terme...
We monitored 9 pluripotent stem cell lines across three time points of hepatic directed differentiation, representing 3 developmental stages: undifferentiated (T0), definitive endoderm (T5), and early hepatocyte (T24). ESCs (n=3) and patient-derived normal (n=3) or PiZZ (n=3) iPSCs were analyzed in ...
We monitored 9 pluripotent stem cell lines across three time points of hepatic directed differentiation, representing 3 developmental stages: undifferentiated (T0), definitive endoderm (T5), and early hepatocyte (T24). ESCs (n=3) and patient-derived normal (n=3) or PiZZ (n=3) iPSCs were analyzed in ...
We monitored 9 pluripotent stem cell lines across three time points of hepatic directed differentiation, representing 3 developmental stages: undifferentiated (T0), definitive endoderm (T5), and early hepatocyte (T24). ESCs (n=3) and patient-derived normal (n=3) or PiZZ (n=3) iPSCs were analyzed in ...
Sparse data exist regarding the normal range of composition of maternal milk beyond the first postnatal weeks. This single timepoint, observational study in collaboration with the 'Parenting Science Gang' citizen science group evaluated the metabolite and bacterial composition of human milk from 62 ...
Tropical theileriosis in a cattle disease of global economic importance, caused by the tick-borne protozoan parasite Theileria annulata. Conventional control strategies are failing to contain the disease and an attractive alternative is the use of pre-existing genetic resistance or tolerance. Howe...
Background The response of macrophages to danger signals is an important early stage in the immune response. Our understanding of this complex event has been furthered by microarray analysis, which allows the simultaneous investigation of the expression of large numbers of genes. However, the mic...
One of the body fluids often used in metabolomics studies is urine. The peak intensities of metabolites in urine are affected by the urine history of an individual resulting in dilution differences. This requires therefore normalization of the data to correct for such differences. Two normalization ...
