Sort   by:  
 Page size 
GenomicsGenome-scale expression and transcription factor binding profiles reveal therapeutic targets in transgenic ERG myeloid leukemia
Here we show that pan-haematopoietic ERG expression driven by the Vav promoter induces an early progenitor myeloid leukemia in transgenic mice. Integrated genome-scale analysis of gene expression and ERG binding profiles revealed that ERG activates a transcriptional program similar to human AML stem...
ORGANISM(S): Mus musculus 
2013-08-30 | E-GEOD-46554 | biostudies-arrayexpress
ProteomicsKetone flux through BDH1 supports metabolic remodeling of skeletal and cardiac muscles in response to intermittent time-restricted feeding
Time-restricted feeding (TRF) has gained attention as a dietary regimen that promotes metabolic health. This study sought to determine if ketone flux in skeletal and cardiac muscles plays an essential role in conferring the health benefits of an intermittent TRF (iTRF) schedule. Notably, we found th...
ORGANISM(S): Mus Musculus (mouse) 
2024-02-09 | PXD047114 | JPOST Repository
MetabolomicsSuboxic DOM is bioavailable to surface prokaryotes in a simulated overturn of an oxygen minimum zone, Devil’s Hole, Bermuda
Oxygen minimum zones (OMZs) are expanding due to increased sea surface temperatures, subsequent increased oxygen demand through respiration, reduced oxygen solubility, and thermal stratification driven in part by anthropogenic climate change. Devil's Hole, Bermuda is a model ecosystem to study OMZ m...
2024-02-27 | MTBLS8122 | MetaboLights
TranscriptomicsNovel male-biased expression in paralogs of the aphid slilmfast nutrient amino acid transporter expansion
A major goal of molecular evolutionary biology is to understand the fate and consequences of duplicated genes. In this context, aphids are particularly intriguing because the newly sequenced pea aphid genome is characterized by extraordinarily high levels of lineage-specific gene duplication relativ...
ORGANISM(S): Myzus persicae 
2011-09-13 | E-GEOD-31024 | biostudies-arrayexpress
GenomicsSingle-cell analyses of regulatory network perturbations using enhancer-targeting TALEs suggest novel roles for PU.1 during haematopoietic specification
The aim of this study was to determine the genomic binding sites of an HA-tagged Transcription Activator-Like Effector (TALE) fused to a VP64 domain with a DNA binding domain designed to bind the sequence GGGCGCTTCCTGTTTTCTCA (found in the PU.1-14kb enhancer element in mouse and human genome), terme...
ORGANISM(S): Mus musculus 
2014-11-05 | E-GEOD-61189 | biostudies-arrayexpress
TranscriptomicsGenome-scale analysis in blood progenitor and mast cells reveals how lineage-affiliated transcription factors control distinct regulatory programs [ChIP-Seq/RNA-Seq Experiments]
Despite major advances in the generation of genome-wide binding maps, the mechanisms by which transcription factors (TFs) regulate cell type identity have remained largely obscure. Through comparative analysis of 10 key haematopoietic TFs in both mast cells and blood progenitors, we demonstrate that...
ORGANISM(S): Mus musculus 
2014-04-24 | E-GEOD-48085 | biostudies-arrayexpress
TranscriptomicsGenome wide analysis of Adrenal Gland tissue from Gata6 conditional knockout versus Control Adrenal tissue
Transcription factor GATA6 is expressed in the fetal and adult adrenal cortex and has been implicated in steroidogenesis. To characterize the role of GATA6 in adrenocortical development and function, we generated mice in which Gata6 was conditionally deleted using Cre-LoxP recombination with Sf1-cre...
ORGANISM(S): Mus musculus 
2013-06-06 | E-GEOD-40398 | biostudies-arrayexpress
GenomicsCytokine-mediated differentiation reflects genome-wide loss of a uSTAT transcriptional program
uSTAT transcriptional program HPC7 cells were fixed with either 1% formaldehyde for 10 mins. Chromatin was isolated, sonicated for 7 mins (30 sec on, 30 sec off), and specific antibodies were used to pull down the transcription factors of insterest after a pre-clearing step. Chromatin was washed, de...
ORGANISM(S): Mus musculus 
2016-01-05 | E-GEOD-70697 | biostudies-arrayexpress
ProteomicsDisruption of STIM1-mediated Ca2+ sensing and energy metabolism in adult skeletal muscle compromises exercise tolerance, proteostasis and lean mass
STIM1 is a single-pass transmembrane endoplasmic/sarcoplasmic reticulum (E/SR) protein recognized for its role in store operated Ca2+ entry (SOCE), an ancient and ubiquitous signaling pathway. Whereas STIM1 is indispensable during development, its biological and metabolic functions in mature muscle ...
ORGANISM(S): Mus Musculus (mouse) 
2021-12-30 | PXD030674 | JPOST Repository
ProteomicsComamonas KF-1 PET degradation
Cellular and extracellular fractions of Comamonas testosteroni KF-1 grown on PET +/- acetate, labeled via diDO-IPTL (Waldbauer et al. 2017 Analytical Chemistry) for protein expression quantitation
ORGANISM(S): Comamonas Testosteroni Kf-1 (ncbitaxon:399795) 
MSV000095794 | MassIVE
Sort   by:  
 Page size