Genome-wide Transcriptional Analysis of Genes Associated with Desiccation Stress in Anopheles gambiae
Ontology highlight
ABSTRACT:
ORGANISM(S): Anopheles gambiae
SUBMITTER: Mei-Hui Wang
PROVIDER: E-GEOD-25433 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:Anopheles gambiae mosquitoes play an important role in malaria transmission. In sub-Saharan Africa, the dry season can last several months. The mechanisms for mosquito population to survive through the dry season are poorly understood. One possible mechanism is that adults increase their desiccation tolerance over the dry season. Genetic analyses have shown that inversions 2La, 2Rb, 2Rc, 2Rd and 2Ru are associated with aridity resistance, however little is known about the transcriptional response of genes in response to desiccation. The results of the present study demonstrate that desiccation affects expression of genes associated with several mosquito physiological mechanisms, including those that protect against water loss, but all structural related genes decreased their expression. The identified differentially expressed genes in response to desiccation stress can lay a foundation for better understanding of molecular mechanisms underling dry-season survival of An. gambiae mosquitoes, so it may provide a different option for malaria vector control.
2011-12-31 | GSE25433 | GEO
Project description:Senescence is a biological phenomenon experienced by all living eukaryote organisms. Genome-wide gene expression associated with aging has been explored in model organisms such as Drosophila melanogaster and Caenorhabditis elegans, but this has not been well understood in African malaria vector, Anopheles gambiae. Gene expression profiling using DNA microarray allows for simultaneous study of changes in mRNA levels for thousands of genes. This study examined genome-wide gene expression during aging process in An. gambiae. The influence of blood feeding on gene expression was also examined. The data can be used to further our understanding of mosquito senescence and identify biomarkers for mosquito age grading. Transcriptional profiles of Anopheles gambiae female mosquitoes were determined at 1, 4, 10, 19 and 28 days post adult eclosion. Additionally mosquitoes that had access to blood meals were compared to those that were maintained with access to only water and sugar.
2010-12-31 | E-GEOD-19756 | biostudies-arrayexpress
Project description:Transcriptional responses in the gut of the main malaria vector Anopheles gambiae following oral bacterial infection with the entomopathogen Serratia marcescens were identified using DNA microarrays. S. marcescens is a common member of the mosquito gut microbiota, found in both laboratory reared and field collected mosquitoes, that can be potentially pathogenic as in Drosophila (Nehme et al., 2007), while it has been shown to influence the outcome of Plasmodium infections (Bando et al., 2013). S. marcescens belongs to the Enterobacteriaceae family, members of which have been shown to influence malaria transmission dynamics (Cirimotich et al., 2011, Boissiere et al., 2012). To further investigate the interactions between S. marcescens and the mosquito host, likely to shape, directly or indirectly, malaria transmission dynamics, An. gambiae mosquitoes, from the recently established N'gousso M form laboratory colony that retains much of the genetic variation of field mosquitoes, were antibiotic treated for 5 days and subsequently orally infected with the Db11-GFP strain of S. marcescens. Bacteria-fed mosquitoes were selected 2 days post infection, and, 3 days post infection, guts from bacteria-fed mosquitoes were dissected. Uninfected control mosquitoes were treated in the same way. Differential expression in the gut of S. marcescens infected mosquitoes, compared to uninfected controls, was identified by hybridizing labelled complementary RNA, derived from total RNA extracted from the respective gut pools, in customized Agilent 4x44k gene expression microarrays, comprising oligonucleotide probes encompassing all An. gambiae annotated genes of the AgamP3.6 release, with each probe represented in duplicate.
2013-11-30 | E-MEXP-3952 | biostudies-arrayexpress
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.
2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress
Project description:The Anopheles gambiae midgut harbors bacteria that proliferate upon a blood feed. We used microarrays to examine the midgut gene expression response at early stages (3hours) after an artifitial meal containing heat killed bacteria. Anopheles gambiae G3 mosquitoes 5-6 day-old were fed BSA (20% in PBS with fresh 10 mM sodium bicarbonate) with or without heat killed E. coli (equivalent of 2.5 ml of 0.8 OD) . Three pools of 10 mosquito midguts were dissected after 3h and processed for microarray analysis of gene expression.
2010-02-21 | E-GEOD-20204 | biostudies-arrayexpress
Project description:Spermatogenesis is a highly complex developmental process, during which diploid germline stem cells are transformed into motile haploid spermatozoa. The process involves a precisely regulated action of a large number of genes, making the testes the most distinct tissue within the body. Testis transcriptome has been analysed in several groups of animals, but never systematically studied in mosquitoes. This dataset, consisting of the transcriptome of the developing testes from late larvae and early pupae of the African malaria mosquito, Anopheles gambiae, closes the existing gap.
2016-01-21 | E-MTAB-3264 | biostudies-arrayexpress
Project description:Blood feeding is an integral process of the malaria vector Anopheles required for its physiological functions and its propagation. During blood feeding, presence of the malaria parasite, Plasmodium in the blood induces several host effector molecules including microRNAs which play important roles in the development and maturation of the parasite within the mosquito. The present study was undertaken to elucidate the dynamic expression of miRNAs during gonotrophic cycle and parasite development in Anopheles stephensi.For this purpose, small RNA sequencing was done in sugar fed, 42 hours and 5 days post blood fed and infected blood fed female mosquitoes to identify regulated miRNAs under these conditions.
2014-06-01 | E-MTAB-2045 | biostudies-arrayexpress
Project description:Anopheles gambiae mosquitoes of the M form N'gousso laboratory colony were antibiotic treated and subsequently orally infected with the Db11-GFP fluorescent strain of Serratia marcescens. Bacteria-fed mosquitoes were separated 2 days post infection based on the presence in the mosquito gut of a dye contained in the sugar solution. Mosquitoes were dissected 5 days post infection and the level of S. marcescens infection was determined through microscopic observation of mosquito guts under a fluorescence microscope. Highly infected mosquitoes, with an extensive presence of fluorescent S. marcescens throughout their gut and non-infected mosquitoes, with no sign of fluorescence traced in their gut, were further used for SNP genotyping. Genomic DNA from pools of 15 highly infected and 15 non-infected mosquitoes, in equimolar amounts, was hybridized in a customized Affymetrix 400k SNP genotyping arrays, interrogating genetic variation at ~400,000 variable positions in the An. gambiae genome, as determined by a previous sequencing effort of M/S An. gambiae molecular forms. Allele calls in both array hybridizations were used to determine the minor allele frequency difference for each individual SNP between the two phenotypic pools, which were subsequently used to determine loci associated with the outcome of S. marcescens infection.
2013-11-30 | E-MEXP-3951 | biostudies-arrayexpress
Project description:Blood feeding is an integral process of the malaria vector Anopheles required for its physiological functions and its propagation. During blood feeding, presence of the malaria parasite, Plasmodium in the blood induces several host effector molecules including microRNAs which play important roles in the development and maturation of the parasite within the mosquito. The present study was undertaken to elucidate the dynamic expression of miRNAs during gonotrophic cycle and parasite development in Anopheles stephensi.For this purpose, miRNA microarray was done in sugar fed, 42 hours post blood fed and 42 hours post infected blood fed female mosquitoes to identify regulated miRNAs under these conditions.
2014-06-01 | E-MTAB-2009 | biostudies-arrayexpress
Project description:The mosquito Anopheles gambiae uses its innate immune system to control bacterial and Plasmodium infection of its midgut tissue. The activation of potent IMD pathway-mediated anti-Plasmodium falciparum defenses is dependent on the presence of the midgut microbiota, which activate this defense system upon parasite infection through a peptidoglycan recognition protein, PGRPLC. We employed transcriptomic and reverse genetic analyses to compare the P. falciparum infection-responsive transcriptomes of septic and aseptic mosquitoes and to determine whether bacteria-independent anti-Plasmodium defenses exist. To examine the impact of P. falciparum infection on the mosquito midgut and carcass transcriptomes in the presence or absence of midgut bacteria, we used A. gambiae whole genome microarrays to compare the mRNA abundance of P. falciparum-infected and -naïve mosquitoes of antibiotic- and non-antibiotic treated cohorts. P. falciparum infection induced changes in the abundance of as many as 2,183 and 2,429 transcripts in whole mosquitoes belonging to a variety of functional groups in aseptic and septic mosquitoes. Ultimately, we were interested in identifying the genes involved in bacteria-independent anti-Plasmodium responses, and therefore we focused on transcripts displaying increased abundance in the parasite-infected aseptic midguts, placing a particular emphasis on those with predicted immune functions. Because of the central role of serine protease cascades in regulating insect immune defenses, we focused the remainder of our analysis on a clip-domain serine protease C2 (CLIPC2, AGAP004317) and a serine protease inhibitor 7 (SRPN7, AGAP007693) that were specifically upregulated in the parasite-infected, aseptic mosquito midgut. We showed that SRPN7 negatively and CLIPC2 positively regulate the anti-Plasmodium defense, independently of the midgut-associated bacteria. Co-silencing assays suggested that these two genes may function together in a signaling cascade. Neither gene was regulated, nor modulated, by infection with the rodent malaria parasite Plasmodium berghei, suggesting that SRPN7 and CLIPC2 are components of a defense system with preferential activity towards P. falciparum. Further analysis using RNA interference determined that these genes do not regulate the anti-Plasmodium defense mediated by the IMD pathway, and both factors act as agonists of the endogenous midgut microbiota, further demonstrating the lack of functional relatedness between these genes and the bacteria-dependent activation of the IMD pathway. This is the first study confirming the existence of a bacteria-independent, anti-P. falciparum defense. Aseptic and septic midguts and carcasses from P. falciparum-infected A. gambiae vs aseptic and septic midguts and carcasses from uninfected, blood-fed A. gambiae. 3 biological replicates and 1 pseudo-replicate per each array.
2013-08-10 | E-GEOD-49690 | biostudies-arrayexpress