Gene Expression Profiling Data of African Malaria Vector Anopheles gambiae Aging
Ontology highlight
ABSTRACT:
ORGANISM(S): Anopheles gambiae
SUBMITTER: Mei-Hui Wang
PROVIDER: E-GEOD-19756 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:Anopheles gambiae mosquitoes play an important role in malaria transmission. In sub-Saharan Africa, the dry season can last several months. The mechanisms for mosquito population to survive through the dry season are poorly understood. One possible mechanism is that adults increase their desiccation tolerance over the dry season. Genetic analyses have shown that inversions 2La, 2Rb, 2Rc, 2Rd and 2Ru are associated with aridity resistance, however little is known about the transcriptional response of genes in response to desiccation. The results of the present study demonstrate that desiccation affects expression of genes associated with several mosquito physiological mechanisms, including those that protect against water loss, but all structural related genes decreased their expression. The identified differentially expressed genes in response to desiccation stress can lay a foundation for better understanding of molecular mechanisms underling dry-season survival of An. gambiae mosquitoes, so it may provide a different option for malaria vector control. Transcriptional profiles of Anopheles gambiae female mosquitoes were exposed to 70% (standard) or 30% (desiccated) RH without any access to sugar and water at 0hr, 18hr or 36hr.
2011-12-31 | E-GEOD-25433 | biostudies-arrayexpress
Project description:The Anopheles gambiae midgut harbors bacteria that proliferate upon a blood feed. We used microarrays to examine the midgut gene expression response at early stages (3hours) after an artifitial meal containing heat killed bacteria. Anopheles gambiae G3 mosquitoes 5-6 day-old were fed BSA (20% in PBS with fresh 10 mM sodium bicarbonate) with or without heat killed E. coli (equivalent of 2.5 ml of 0.8 OD) . Three pools of 10 mosquito midguts were dissected after 3h and processed for microarray analysis of gene expression.
2010-02-21 | E-GEOD-20204 | biostudies-arrayexpress
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.
2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress
Project description:Blood feeding is an integral process of the malaria vector Anopheles required for its physiological functions and its propagation. During blood feeding, presence of the malaria parasite, Plasmodium in the blood induces several host effector molecules including microRNAs which play important roles in the development and maturation of the parasite within the mosquito. The present study was undertaken to elucidate the dynamic expression of miRNAs during gonotrophic cycle and parasite development in Anopheles stephensi.For this purpose, small RNA sequencing was done in sugar fed, 42 hours and 5 days post blood fed and infected blood fed female mosquitoes to identify regulated miRNAs under these conditions.
2014-06-01 | E-MTAB-2045 | biostudies-arrayexpress
Project description:The mosquito Anopheles gambiae uses its innate immune system to control bacterial and Plasmodium infection of its midgut tissue. The activation of potent IMD pathway-mediated anti-Plasmodium falciparum defenses is dependent on the presence of the midgut microbiota, which activate this defense system upon parasite infection through a peptidoglycan recognition protein, PGRPLC. We employed transcriptomic and reverse genetic analyses to compare the P. falciparum infection-responsive transcriptomes of septic and aseptic mosquitoes and to determine whether bacteria-independent anti-Plasmodium defenses exist. To examine the impact of P. falciparum infection on the mosquito midgut and carcass transcriptomes in the presence or absence of midgut bacteria, we used A. gambiae whole genome microarrays to compare the mRNA abundance of P. falciparum-infected and -naïve mosquitoes of antibiotic- and non-antibiotic treated cohorts. P. falciparum infection induced changes in the abundance of as many as 2,183 and 2,429 transcripts in whole mosquitoes belonging to a variety of functional groups in aseptic and septic mosquitoes. Ultimately, we were interested in identifying the genes involved in bacteria-independent anti-Plasmodium responses, and therefore we focused on transcripts displaying increased abundance in the parasite-infected aseptic midguts, placing a particular emphasis on those with predicted immune functions. Because of the central role of serine protease cascades in regulating insect immune defenses, we focused the remainder of our analysis on a clip-domain serine protease C2 (CLIPC2, AGAP004317) and a serine protease inhibitor 7 (SRPN7, AGAP007693) that were specifically upregulated in the parasite-infected, aseptic mosquito midgut. We showed that SRPN7 negatively and CLIPC2 positively regulate the anti-Plasmodium defense, independently of the midgut-associated bacteria. Co-silencing assays suggested that these two genes may function together in a signaling cascade. Neither gene was regulated, nor modulated, by infection with the rodent malaria parasite Plasmodium berghei, suggesting that SRPN7 and CLIPC2 are components of a defense system with preferential activity towards P. falciparum. Further analysis using RNA interference determined that these genes do not regulate the anti-Plasmodium defense mediated by the IMD pathway, and both factors act as agonists of the endogenous midgut microbiota, further demonstrating the lack of functional relatedness between these genes and the bacteria-dependent activation of the IMD pathway. This is the first study confirming the existence of a bacteria-independent, anti-P. falciparum defense. Aseptic and septic midguts and carcasses from P. falciparum-infected A. gambiae vs aseptic and septic midguts and carcasses from uninfected, blood-fed A. gambiae. 3 biological replicates and 1 pseudo-replicate per each array.
2013-08-10 | E-GEOD-49690 | biostudies-arrayexpress
Project description:Blood feeding is an integral process of the malaria vector Anopheles required for its physiological functions and its propagation. During blood feeding, presence of the malaria parasite, Plasmodium in the blood induces several host effector molecules including microRNAs which play important roles in the development and maturation of the parasite within the mosquito. The present study was undertaken to elucidate the dynamic expression of miRNAs during gonotrophic cycle and parasite development in Anopheles stephensi.For this purpose, miRNA microarray was done in sugar fed, 42 hours post blood fed and 42 hours post infected blood fed female mosquitoes to identify regulated miRNAs under these conditions.
2014-06-01 | E-MTAB-2009 | biostudies-arrayexpress
Project description:We aimed at identifying the genes regulated by wounding in Anopheles gambiae. Gene expression was compared between wounded and non-wounded mosquitoes, 3h after wounding. Wounding was induced by the injection of dsLacZ using a thin glass needle.
2013-06-05 | E-MEXP-3677 | biostudies-arrayexpress
Project description:With their genome sequenced, Anopheles gambiae mosquitoes now serve as a powerful tool for basic research in comparative, evolutionary and developmental biology. The knowledge generated by these studies is expected to reveal molecular targets for novel vector control and pathogen transmission blocking strategies. Comparisons of gene-expression profiles between adult male and nonblood-fed female Anopheles gambiae mosquitoes revealed that roughly 22% of the genes showed sex-dependent regulation. Blood-fed females switch the majority of their metabolism to blood digestion and egg formation within 3 h after the meal is ingested, in detriment to other activities such as flight and response to environment stimuli. Changes in gene expression are most evident during the first, second and third days after a blood meal, when as many as 50% of all genes showed significant variation in transcript accumulation. After laying the first cluster of eggs (between 72 and 96 h after the blood meal), mosquitoes return to a nongonotrophic stage, similar but not identical to that of 3-dayold nonblood-fed females. Ageing and/or the nutritional state of mosquitoes at 15 days after a blood meal is reflected by the down-regulation of 5% of all genes. A full description of the large number of genes regulated at each analysed time point and each biochemical pathway or biological processes in which they are involved is not possible within the scope of this contribution. Therefore, we present descriptions of groups of genes displaying major differences in transcript accumulation during the adult mosquito life. However, a publicly available searchable database (Anopheles gambiae Gene Expression Database at UC Irvine) has been made available so that detailed analyses of specific groups of genes based on their descriptions, functions or levels of gene expression variation can be performed by interested investigators according to their needs. Experiment Overall Design: 12 Samples analyzed, 3 replicates per sample, Affymetrix internal controls
2008-11-08 | E-GEOD-8822 | biostudies-arrayexpress
Project description:Background: The Anopheles gambiae salivary glands play a major role in malaria transmission and express a variety of bioactive components that facilitate blood-feeding by preventing platelet aggregation, blood clotting, vasodilatation, and inflammatory and other reactions at the probing site on the vertebrate host. Results: We have performed a global transcriptome analysis of the A. gambiae salivary gland response to blood-feeding, to identify candidate genes that are involved in hematophagy. A total of 4,978 genes were found to be transcribed in this tissue. A comparison of salivary gland transcriptomes prior to and after blood-feeding identified 52 and 41 transcripts that were significantly up-regulated and down-regulated, respectively. Ten genes were further selected to assess their role in the blood-feeding process using RNAi-mediated gene silencing methodology. Depletion of the salivary gland genes encoding D7L2, anophelin, peroxidase, the SG2 precursor, and a 5'nucleotidase gene significantly increased probing time of A. gambiae mosquitoes and thereby their capacity to blood-feed. Conclusions: The salivary gland transcriptome comprises approximately 38% of the total mosquito transcriptome and a small proportion of it is dynamically changing already at two hours in response to blood feeding. A better understanding of the salivary gland transcriptome and its function can contribute to the development of pathogen transmission control strategies and the identification of medically relevant bioactive compounds. Salivary glands from blood-fed vs. unfed A. gambiae. 3 replicates.
2011-11-01 | E-GEOD-33385 | biostudies-arrayexpress
Project description:Malaria is caused by Plasmodium parasites, which are transmitted via the bites of infected Anopheline mosquitoes. Midgut invasion is a major bottleneck for Plasmodium development inside the mosquito vectors as a rapidly responding immune system recognizes ookinetes and recruits killing factors from the midgut and surrounding tissues, dramatically reducing the population of invading ookinetes before they can successfully traverse the midgut epithelium. Understanding molecular details of the parasite-vector interactions requires precise measurement of nascent protein synthesis in the mosquito during Plasmodium infection. Current expression profiling primarily monitors alterations in steady-state levels of mRNA, but does not address the equally critical issue of whether the proteins encoded by the mRNAs are actually synthesized. In this study, we used sucrose density gradient centrifugation to isolate actively translating Anopheles gambiae mRNAs based upon their association with polyribosomes (polysomes). The proportion of individual gene transcripts associated with polysomes, which is determined by RNA deep sequencing, reflects mRNA translational status. This approach led to identification of 1017 mosquito transcripts that were primarily regulated at the translational level after ingestion of Plasmodium falciparum-infected blood. Caspar, a negative regulator of the NF-kappaB transcription factor Rel2, appears to be substantially activated at the translational levels during Plasmodium infection. In addition, transcripts of Dcr1, Dcr2 and Drosha, which are involved in small RNA biosynthesis, exhibited enhanced associations with polysomes after P. falciparum challenge. This observation suggests that mosquito microRNAs may play an important role in reactions against Plasmodium invasion. We analyzed both total cellular mRNAs and mRNAs that are associated with polysomes to simultaneously monitor transcriptomes and nascent protein synthesis in the mosquito. This approach provides more accurate information regarding the rate of protein synthesis, and identifies some mosquito factors that might have gone unrecognized because expression of these proteins is regulated mainly at the translational level rather than at the transcriptional level after mosquitoes ingest a Plasmodium-infected blood meal. Midguts from female Anopheles gambiae mosquitoes were dissected at around 24 h after ingestion of P. falciparum-infected blood. Mosquitoes fed on uninfected blood were used as control. A portion of the midguts were used for isolation of total cellular RNA. Extracts of the remaining midguts were fractionated over sucrose density gradients, and fifteen fractions were collected from the top of each gradient. Non-polysomal fractions, as well as polysomal fractions were combined, respectively, to obtain two RNA pools per gradient for three independent experiments. The first, last and the sample between non-polysomal and polysomal, were all discarded to ensure pure pools from each set. A fourth experiment was conducted where the polysomal and non-polysomal samples were not pooled, to be used later for qRT-PCR. The mRNA levels of individual mosquito genes in polysome (PS) fractions, nonpolysome (NP) fractions and unfractionated steady-state (total) RNA were determined using high throughput RNA deep sequencing. Each RNA pool generated 2.1-9.8 million raw read . Signal intensities of transcripts from each PS pool were compared to those of transcripts from a matching NP pool. To quantify the translational status of individual mRNA species, we define the relative PS loading [PL=P/(P+NP)] as the extent of mRNA association with polysomes. PL values were compared between the mosquitoes fed on P. falciparum-infected or -uninfected blood.
2012-09-21 | E-GEOD-38707 | biostudies-arrayexpress