Browse
Submit Data
Databases
API
Help

Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

12 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Gene expression signature of EGR3 silencing in M12 human prostate cancer cells

ABSTRACT: EGR3 expression is upregulated in human prostate cancer compared to normal prostate tissue and is associated with absence of relapse, while low EGR3 expression in tumors is predicitive of disease relapse (Pio et al., PLOS One 2013; 8(1):e54096). However the function of EGR3 in prostate cancer is unknown. Human prostate cancer cells M12 containing high levels of EGR3 were used for shRNA-mediated silencing of EGR3. Gene expression analysis of EGR3 knockdown cells reveals a role in inflammation and the existence of a crosstalk with the NFkB pathway. The M12 prostate cancer cell line is a tumorigenic derivative of the P69 SV40-T immortalized epithelial cells obtained through serial passages of P69 tumor xenografts in mice (Bae et al., Prostate 1998; 34:275-82). M12 cells were transfected with shRNA scramble plasmid (shSCR) or shEGR3 plasmid and selected with puromycin (1 μg/ml). Single-cell clones were isolated using standard methods. Stably transfected cells (shSCR-M12 and shEGR3-M12) were then maintained in growth medium supplemented with puromycin. Two separate clones (termed cl 2 and cl 3) were studied. Knockdown of EGR3 (50% efficacy on average) was stable over many cell culture passages. Biological duplicates of control cells (scramble shRNA) and of two separate clones of shEGR3 cells (clone 2 and clone 3) were used for the gene expression arrays (i.e. 6 samples).

ORGANISM(S): Homo sapiens

SUBMITTER: Zhenyu Jia

PROVIDER: E-GEOD-52108 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

Gene expression signature of EGR3 silencing in M12 human prostate cancer cells

Project description:EGR3 expression is upregulated in human prostate cancer compared to normal prostate tissue and is associated with absence of relapse, while low EGR3 expression in tumors is predicitive of disease relapse (Pio et al., PLOS One 2013; 8(1):e54096). However the function of EGR3 in prostate cancer is unknown. Human prostate cancer cells M12 containing high levels of EGR3 were used for shRNA-mediated silencing of EGR3. Gene expression analysis of EGR3 knockdown cells reveals a role in inflammation and the existence of a crosstalk with the NFkB pathway.

2013-11-06 | GSE52108 | GEO

Global methylation analysis identifies PITX2 as an upstream regulator of the androgen receptor and IGF-I receptor genes in prostate cancer

Project description:The insulin-like growth factor-I (IGF-IR) and androgen (AR) receptors are important players in prostate cancer biology. Functional interactions between the IGF-I and androgen signaling pathways seem to have crucial roles in the progression of prostate cancer from early (benign) to advanced (metastatic) stages. DNA methylation is a major epigenetic alteration affecting gene expression. Hypermethylation of tumor suppressor promoters is a frequent event in human cancer, leading to inactivation and repression of specific genes. The aim of the present study was to identify the entire set of methylated genes (M-bM-^@M-^\methylomeM-bM-^@M-^]) in a cellular model that replicates prostate cancer progression. The methylation profiles of the P69 (early stage, benign) and M12 (advanced stage, metastatic) prostate cancer cell lines were established by treating cells with the demethylating agent 5-Aza-2M-bM-^@M-^Y-deoxycytidine (5-Aza) followed by DNA microarray analysis. Comparative genome-wide methylation analyses of 5-Aza-treated versus untreated cells identified 297 genes overexpressed in P69 and 191 genes overexpressed in M12 cells. One hundred and two genes were upregulated in both benign and metastatic cell lines. In addition, our analyses identified the PITX2 gene as a master regulator upstream of the AR and IGF-IR genes.

2012-12-12 | E-GEOD-34042 | biostudies-arrayexpress

Transcriptomic profile of CTDP1 knockdown in MDA-MB-231 cells

Project description:MDA-MB-231 cells with transfected lentivirus carrying shRNA (shScr, shCTDP1-#1 and shCTDP1-#2) and selected with puromycin. 1000 and 616 genes were found commonly up- and down-regulated in both shCTDP1-#1 and #2.

2023-04-17 | GSE148870 | GEO

A novel small-molecule inhibitor of STAT5A/STAT5B with therapeutic potential for prostate cancer and CML

Project description:We assessed the gene expression profiles induced by both genetic and pharmacological knockdown of Stat5a/b in CML cells. Stat5 was suppressed in K562 cells by lentiviral expression of Stat5 shRNA vs. scramble control for 6 days or by treatment of the cells with IST5-002 (5 µM) for 48 h. K562 cells were treated with IST5-002 (5 µM) or vehicle (DMSO) for 48 h. For Stat5 knockdown, K562 cells were infected with Stat5-shRNA lentivirus or scramble-shRNA lentivirus (as control) for 48 h followed by puromycin (2ug/ml) selection for 6 days to enrich for cells expressing Stat5 or scramble shRNA. Each group (vehicle control, IST5-002, scramble-shRNA control and Stat5-shRNA) was prepared in triplicate, and RNA samples from each group were not pooled.

2015-07-01 | E-GEOD-61312 | biostudies-arrayexpress

Homo sapiens

Project description:Gene expression signature of EGR3 silencing in M12 human prostate cancer cells

| PRJNA226697 | ENA

Profiling of RWPE cells stably over-expressing ETV1

Project description:RWPE benign prostatic epithelial cells were infected with a lentivirus expressing ETV1 or GUS (control), and stable clones were isolated by puromycin selection. ETV1 over-expression, recapitulating ETS gene rearrangements observed in vivo, confers invasiveness in the benign prostate cell line RWPE. Keywords: genetic modification

2007-08-07 | GSE7701 | GEO

Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells

Project description:Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes. LNCaP cells logarthmically growing in full serum was infected with three different shRNA lentiviruses. Three days after infection

2013-05-10 | E-GEOD-46329 | biostudies-arrayexpress

Protein phosphorylation of IFNgR1 knockout B16 cells

Project description:B16 cells were transduced by lentivirus encoding scramble shRNA and engineered to obtain two IFNgR1-knockout cell clones. Proteins from these cells were digested by TPCK-trypsin. Equal amount of peptides were labelled with TMTpro reagents and pooled. Phosphopeptides were enriched from 90% of the pooled peptides using TiO2 beads, and fractionated with the Pierce high pH reversed-phase peptide fractionation kit to get six fractions. The remaining 10% pooled peptides (called total peptides) were fractionated similarly to get five fractions. Peptides from each fraction were analyzed using HPLC-ESI-MS/MS. Some fractions were analyzed twice. TMTpro channels 1-4: four independent samples of scramble shRNA group; channels 5-8: four independent samples of IFNgR1 knockout cell clone 1; channels 9-12: four independent samples of IFNgR1 knockout cell clone 2; channels 13-16: samples not related to this study.

2021-07-12 | MSV000087796 | MassIVE

Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells

2013-05-10 | GSE46329 | GEO

Gene expression profiling of LNCaP cells following shRNA-mediated knockdown of TMEFF2 and growth in presence and absence of dihydrotestosterone

Project description:TMEFF2 is an androgen regulated transmembrane protein mainly restricted to brain and prostate, that functions as a tumor suppressor in prostate cancer (PCa). Studies using publically available prostate cancer (PCa) datasets, reveal changes in the expression of TMEFF2 with disease stage, supporting an important role of TMEFF2 in this disease. However, the role of TMEFF2 in the biology and pathogenesis of PCa is still unknown. Using a transgenic TMEFF2 mouse, we have demonstrated that TMEFF2 overexpression modulates prostate branching morphogenesis, and androgen regulated process, during prostate regeneration. We hypothesized that TMEFF2 may have a regulatory function within androgen signaling that could explain its role in PCa. To better understand its function in androgen signaling and PCa, we compared the transcriptome of LNCaP prostate cancer cells transduced with control shRNA and shRNA targeting TMEFF2 in the presence and absence of dihydrotestosterone (DHT). The results indicated that globally, there is a significant interaction between the effects of DHT and shTMEFF2. Of the 519 genes with significant gene expression changes after DHT treatment of Scramble control cells, 208 (40%) had significant differential expression when the shTMEFF2 +DHT group was compared to Scramble +DHT group, including numerous androgen activated and androgen repressed genes.

2019-04-01 | GSE117180 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data