Project description:Plant and virus materials, inoculation and symptom evaluation<br><br>Tomato seedlings, cultivar Tricia (De Ruiter seeds, Bergschenhoek, the Netherlands) were grown in stonewool in climate chamber conditions (22 and 20°C during day and night periods of 10 and 14 hours, respectively, at 75% relative humidity). At 29 days after planting, plants were inoculated with a mild (1906; GenBank accession number FJ457096) and an aggressive (PCH 06/104; GenBank accession number FJ457097) PepMV isolate of the CH2 genotype. Here, a PepMV isolate is defined as the viral inoculum derived from PepMV infected plants from one specific tomato production site. After inoculation, the genotype of both isolates was determined using a previously described RT-PCR-RFLP method (Hanssen et al., 2008). Inoculation was performed on the second fully developed leaf as previously described (Hanssen et al., 2008). <br><br>The phenotypic response of tomato seedlings upon inoculation was evaluated by recording the development of typical nettlehead-like PepMV symptoms at 4, 8 and 12 days post inoculation (DPI) on 20 plants per treatment. PepMV induced nettlehead-like symptoms are characterized by a reduced leaf surface, leaf bubbling and leaf deformation (Hanssen et al., 2008). Symptoms were scored from 0 (no symptoms) to 3 (severe symptoms) (Figure 1b). Significant (p<0.05) differences in symptom scores were identified by analysis of variance (one-way ANOVA) and post-hoc Bonferroni tests using SPSS software (v. 10.0; SPSS Inc., Chicago, IL, USA).<br><br><br><br>Microarray sample preparation and determination of viral titers<br><br>Tomato genes that were differentially regulated (more than twofold change with P value < 0,001) upon inoculation with the aggressive and mild PepMV isolates were identified at 4, 8 and 12 DPI using mock-inoculated control plants as a reference. At each time point, the youngest fully developed leaves from CH2 mild, CH2 aggressive and mock-inoculated plants were sampled for tomato gene chip hybridizations. Each plant was sampled only once. Three biological replicates, each consisting of pooled RNA extracts obtained from the youngest fully developed leaves of two seedlings, were analyzed per treatment. Total RNA was extracted using the RiboPure RNA extraction kit (Ambion) and reverse transcribed with labeled oligo-dT primers for hybridization onto custom-designed Affymetrix tomato GeneChip arrays (Syngenta Biotechnology, Inc., Research Triangle Park, North Carolina, US) that contains probe sets to interrogate 22,721 tomato transcripts (Van Esse et al., 2007). <br><br>Viral accumulation was measured using a PepMV-specific RT-qPCR assay with forward primer Pep5 (5' ATGAAGCATTCATACCAAAT 3') and reverse primer Pep4 (5' AATTCCGTGCACAACTAT 3'; Mumford & Metcalfe, 2001) respectively. PCR amplification was carried out using a Cepheid® Smart Cycler II thermocycler and analyzed using Smart Cycler software. The PCR program consisted of an initial denaturation step at 95°C for 15 min, 45 cycles of 15s at 94 ºC, 30 s at 50 °C and 30 s at 72 °C, followed by a final incubation step of 2 min at 72°C. Standard curves based on cDNA dilution series were generated to determine the relative concentrations of amplified viral RNA. Based on 4 replicates, run in two different analyses, a reaction efficiency of around 90% was obtained. Ct values obtained from the PepMV specific assay were standardized by subtraction from an internal control assay (efficiency 99%) amplifying a partial sequence of the ribulose 1.5-biphosphate carboxylase chloroplast gene (Sánchez-Navarro et al. 2005).<br><br>
Project description:Phytophthora infestans is most notorious oomycete causing a devastating disease on tomato called late blight. The molecular mechanisms involved in host-parasite interaction is still unexplored well. Investigation of changes in gene expression profile after pathogen infection to find out the mechanisms involved in infection process Second full expanded leaves from both healthy tomato plants (non-inoculated) and diseased tomato plants inoculated with Phytophthora infestans inoculum were used to extract total RNA for microarry analysis 12 hours post inoculation time.
Project description:Male reproductive tissues are more sensitive to heat stress compared to vegetative tissues, however the basis of this phenomenon is poorly understood. Heat stress transcription factors (Hsfs) regulate the transcriptional changes required for protection and recovery from heat stress. HsfA2 has been characterized as co-activator of HsfA1a in tomato and is considered as one of the major Hsfs accumulating in response to elevated temperatures. The role of HsfA2 in heat stress response of different tissues was examined by exploring the composition and structure of the tissue-specific regulatory networks in transgenic tomato plants with suppressed HsfA2 expression (A2AS). Transcriptome analysis revealed that HsfA2 acts in condition- and tissue-specific manner and that only a subset of heat stress induced genes require HsfA2 for higher expression. Remarkably, although HsfA2 is not essential for thermotolerance in seedlings and flowering plants, it is required for maintenance pollen viability under stress conditions. We show that the activation of Hsf networks is important for the developmentally regulated priming of heat stress response occurring at early stages of anther and pollen development. Thereby, HsfA2 is involved in pollen thermotolerance by directly regulating heat stress responsive genes but also by stimulating the synthesis of molecular chaperones under non-stress conditions. 8 samples
Project description:Heat shock proteins (Hsps) are molecular chaperones primarily involved in maintenance of protein homeostasis. Their function has been best characterized in heat stress (HS) response during which Hsps are transcriptionally controlled by heat stress transcription factors (Hsfs). The role of Hsfs and Hsps in HS-response in tomato was initially examined by transcriptome analysis using the Massive Analysis of cDNA Ends (MACE) method. Approximately 9.6% of all genes expressed in leaves are enhanced in response to HS, including a subset of Hsfs and Hsps. The underlying Hsp-Hsf networks with potential functions in stress responses or developmental processes were further explored by meta-analysis of existing microarray datasets. We identified clusters with differential transcript profiles with respect to abiotic stresses, plant organs and developmental stages. The composition of two clusters points toward two major chaperone networks. One cluster consisted of constitutively expressed plastidial chaperones and other genes involved in chloroplast protein homeostasis. The second cluster represents genes strongly induced by heat, drought and salinity stress, including HsfA2 and many stress-inducible chaperones, but also potential targets of HsfA2 not related to protein homeostasis. This observation attributes a central regulatory role to HsfA2 in controlling different aspects of abiotic stress response and tolerance in tomato. 2 samples
Project description:Transcription profiling of roots and shoots of tomato plants as a result of systemic infection with the tospovirus Tomato Spotted Wilt Virus (TSWV).
Project description:We introduced the GAME1i construct into the indeterminate M82 cultivar by crossing, obtaining plants that displayed a phenotype of severe growth retardation, deformed leaves and abortion of flower buds . In addition, leaves of these plants exhibited dark necrotic spots resembling symptoms typically seen after infection of tomato by pathogenic bacteria like Xanthamonas campestris pv. vesicatoria (Xcv) or Pseudomonas syringae pv. tomato (Pst) . As no other tomato lines grown in the same greenhouse at the same time showed similar disease-like symptoms, we hypothesized that silencing GAME1 might mimic induction of disease symptoms in the absence of a pathogen. Indeed, we were able to isolate neither Xcv nor Pst (or other putative pathogens) from GAME1i leaves that displayed necrotic spots. Microarray analysis was performed to examine if the transgene, and possibly, the corresponding changes in the metabolic profile, induced the plant response system at the transcriptional level.
Project description:Ribosome biogenesis is a major cellular processes involving a large inventory of proteinaceous and RNA cofactors. Recent bioinformatics approaches discovered a large but not complete overlap of the inventory between yeast, mammals and plants. We re-inspected the complexity of ribosome biogenesis factors (RBFs) by assigning co-orthologs to each protein family in the A. thaliana and S. lycopersicum genomes. We realized that about 25% of all analyzed RBFs in the two plant genomes are encoded by more than one gene. The majority is expressed in leaves and anthers of tomato as determined by next generation sequencing (NGS). For the analysis of NGS data we developed a software pipeline M-bM-^@M-^XCRACPipeM-bM-^@M-^Y. This pipeline is designed to be very flexible with respect to genome selection and experimental set up. The NGS analysis revealed the expression of 24.538 genes in tomato leaves and of 22.893 genes in anthers. The observed expression of RBFs was confirmed by qRT-PCR for a randomly chosen sub-set of genes. Further, analysis of the expression profile of selected RBFs during male gametophyte development revealed a differential expression in the different developmental stages for the majority of genes. Based on our analysis we conclude that RBFs described in yeast but not present in plant genomes as concluded from previous orthology analysis are in parts replaced by other RBFs for which multiple genes have been identified in here. In addition, the obtained complexity for some RBFs accounts for a tissue and developmental specific regulation of ribosome biogenesis as well. 2 samples
Project description:Current protection strategies against the fungal pathogen Botrytis cinerea rely on a combination of conventional fungicides and host genetic resistance. Defence elicitors can stimulate plant defence mechanisms through a phenomenon known as priming. Priming results on a faster and/or stronger expression of resistance upon pathogen attack. This work aims to study priming of a commercial formulation of the elicitor Chitosan. Treatments with Chitosan result in induced resistance in solanaceous and brassicaceous plants. Large-scale transcriptomic analysis in this study revealed that Chitosan primes gene expression at early time-points after infection. Four conditions were analysed using microarrays: (i) water-treated and non-infected plants (Water + Mock); (ii) Chitosan-treated and non-infected plants (Chitosan + Mock); (iii) water-treated and B. cinerea-infected plants (Water + B. cinerea); (iv) Chitosan-treated and B. cinerea-infected plants (Chitosan + B. cinerea). Inoculations were performed four days after treatment with Chitosan, and leaf discs from four independent plants (biological replicates) per treatment were sampled at 6 h, 9 h and 12 h post-inoculation (hpi) with water mock or B. cinerea spores.
Project description:Pseudomonas syringae pv. tomato DC3000 (Pst) is a virulent pathogen, which causes disease on tomato and Arabidopsis. The type III secretion system (TTSS) plays a key role in pathogenesis by translocating virulence effectors from the bacteria into the plant host cell, while the phytotoxin coronatine (COR) contributes to virulence and disease symptom development. Recent studies suggest that both the TTSS and and COR are involved in the suppression of host basal defenses. However, little is known about the interplay between the host gene expression associated with basal defenses and the virulence activities of the TTSS and COR during infection. The global effects of the TTSS and COR on host gene expression associated with other host cellular processes during bacterial infection are also not well characterized. In this study, we used the Affymetrix full genome chip to determine the Arabidopsis transcriptome associated with basal defense to Pst DC3000 hrp mutants and the human pathogenic bacterium Escherichia coli O157:H7. We then used Pst DC3000 virulence mutants to characterize Arabidopsis transcriptional responses to the action of hrp-regulated virulence factors (e.g., TTSS and COR) during bacterial infection. Additionally, we used bacterial fliC mutants to assess the role of the PAMP flagellin in induction of basal defense-associated transcriptional responses. In total, our global gene expression analysis identified more than 5000 Arabidopsis genes that are reproducibly regulated more than 2-fold in three independent biological replicates of at least one type of comparison. Regulation of these genes provides a molecular signature for Arabidopsis basal defense to plant and human pathogenic bacteria, and illustrates both common and distinct global virulence effects of the TTSS, COR, and possibly other hrp-regulated virulence factors during Pst DC3000 infection. Experimenter name = William Underwood; Experimenter phone = 517-353-9182; Experimenter fax = 517-353-9168; Experimenter address = Michigan State University; Experimenter address = 222 Plant Biology Building; Experimenter address = 178 Wilson R.d. Experimenter address = East Lansing, MI; Experimenter zip/postal_code = 48824; Experimenter country = USA Experiment Overall Design: 40 samples were used in this experiment