Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

Promoter capture-C of primary HepG2 cells

ABSTRACT: We employed a massively parallel, high resolution Capture-C based method to simultaneously characterize the genome-wide interactions of all human promoters in any cell type. We applied this approach to study the promoter interactome of HepG2 cells (3 biological replicates). We designed a custom Agilent SureSelect library targeting both ends of DpnII restriction fragments that overlap promoters of protein-coding, noncoding, antisense, snRNA, miRNA, snoRNA and lincRNA transcripts. Each library was sequenced on 4 lanes of an Illumina HiSeq 4000.

INSTRUMENT(S): Illumina HiSeq 4000

ORGANISM(S): Homo sapiens

SUBMITTER: Wells Andrew

PROVIDER: E-MTAB-7144 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Publications

Genome-scale Capture C promoter interactions implicate effector genes at GWAS loci for bone mineral density.

Chesi Alessandra A Wagley Yadav Y Johnson Matthew E ME Manduchi Elisabetta E Su Chun C Lu Sumei S Leonard Michelle E ME Hodge Kenyaita M KM Pippin James A JA Hankenson Kurt D KD Wells Andrew D AD Grant Struan F A SFA

Nature communications 20190319 1

Osteoporosis is a devastating disease with an essential genetic component. GWAS have discovered genetic signals robustly associated with bone mineral density (BMD), but not the precise localization of effector genes. Here, we carry out physical and direct variant to gene mapping in human mesenchymal progenitor cell-derived osteoblasts employing a massively parallel, high resolution Capture C based method in order to simultaneously characterize the genome-wide interactions of all human promoters. ...[more]

PMID: 30890710

Similar Datasets

Project description:Three-dimensional genome structure plays an important role in gene regulation. Globally chromosomes are organized into active and inactive compartments, while at the gene level looping interactions connect promoters to regulatory elements. Topologically Associating Domains (TADs), typically several hundred kilobases in size form an intermediate level of organization. Major questions include how TADs are formed and what their relation is with looping interactions between genes and regulatory elements. Here we performed a focused 5C analysis of a 2.8 Mb region on chromosome 7 surrounding CFTR in a panel of cell types. We find that the same TAD boundaries are present in all cell types, indicating that TADs represent a universal chromosome architecture. Further, we find that these TAD boundaries are present irrespective of expression and looping of genes located between them. In contrast looping interactions between promoters and regulatory elements are cell-type specific and occur mostly within TADs. This is exemplified by the CFTR promoter that in different cell types interacts with distinct sets of distal cell type-specific regulatory elements that are all located within the same TAD. Finally, we find that long-range associations between loci located in different TADs are also detected but these display much lower interaction frequencies than looping interactions within TADs. Interestingly, interactions between TADs are also highly cell type-specific and often involve loci clustered around TAD boundaries. These data point to key roles of invariant TAD boundaries in constraining as well as mediating cell type-specific long-range interactions and gene regulation. We investigated a 2.8 Mb region on Chromosome 7 (hg18 chr7: 115797757-118405450) containing the ENCODE region ENm001 42. The 5C experiment was designed to interrogate looping interactions between HindIII fragments containing transcription start sites (TSSs) and any other HindIII restriction fragment (distal fragments) in the target region. Libraries were generated for five cell lines: Caco2, Calu3, Capan1, GM12878 and HepG2, with two biological replicates for each line. 5C probes were designed at HindIII restriction sites (AAGCTT) using 5C primer design tools previously developed and made publicly available online at our My5C website (http://my5C.umassmed.edu). Probes were designed based on the ENCODE manual region 1 (ENM001) design 25 with additional probes placed throughout the region when appropriate. We also added probes to extend the analysis to include a 700 Kb gene desert region located directly adjacent to ENM001. Probe settings were: U-BLAST, 3; S-BLAST, 100; 15-MER, 3,000; MIN_FSIZE, 250; MAX_FSIZE, 20,000; OPT_TM, 65; OPT_PSIZE, 40. We designed 74 reverse 5C probes, and 605 forward 5C probes.

Project description:CCAT1-L is a highly expressed long noncoding RNA located in the colorectal cancer specific super enhance region about 500 kb upstream of MYC gene. Knockdown of CCAT1-L significantly down-regulated interaction frequency between CCAT1 and MYC locus and repress MYC expression, suggesting a long-range chromatin interaction between CCAT1-L and MYC locus maintained by CCAT1-L underlie the MYC regulation. To further validate this hypothesis, multiplexed 3C sequencing (3C-seq) was employed to evaluate chromatin interaction strength between CCAT1-L and MYC locus in CCAT1-L knockdown and scramble knockdown (Scr) HT29 cells. The 3C-Seq design and data analysis were performed according to Stadhouders et al, Nat Protoc. 2013, 8:509-524. A series of bait sequences accommodating different locus around CCAT1-L and MYC were selected. Through integrating with specific sample barcodes, bait-specific primer sets were designed to construct relevant 3C-seq libraries in CCAT1-L knockdown and scramble knockdown (Scr) HT29 samples. All of the 3C sample libraries from different treatment, including CCAT1-L knockdown and scramble knockdown (Scr), were then pooled together for high-throughput sequencing. Two technical 3C-seq were performed (CCAT1_myc_3C_1.txt.gz and CCAT1_myc_3C_2.txt.gz) and then combined together to get enough reads for further analysis. 3C-seq reads from different samples were divided according to sample barcodes (CCAT1-L knockdown: ATGTCA; Scr: GCCAAT) and different bait sequences, and then mapped to human reference genome to assess chromatin interaction strength between CCAT1-L and MYC locus in different treatments. In our study, one representative bait-specific sequencing data (CTTCTACTGATTGGCCCTAAACACTTTTCCAAAGCTT) was select to generate bedgraph files and upload to UCSC for visualization to show the chromatin interaction between CCAT1-L and Myc locus in CCAT1-L knockdown (CCAT1-L_knockdown_out.bedgraph) and scramble knockdown (Scr_out.bedgraph) samples.

Project description:DNA methylation in CpG context is fundamental to the epigenetic regulation of gene expression in high eukaryotes. Disorganization of methylation status is implicated in many diseases, cellular differentiation, imprinting, and other biological processes. Techniques that enrich for biologically relevant CpG-rich genomic regions are desired since, depending on the size of an oragnism's methylome, the depth of sequencing required to cover all CpGs can be prohibitively expensive. Currently, restriction-enzyme based Reduced Representation Bisulfite Sequencing and its modified protocols are widely used to study methylation differences. Recently, Agilent Technologies and Roche NimbleGen have aimed to both reduce sequencing costs and capture CpGs of known biological relevance by marketing in-solution custom-capture hybridization platforms. These three methods target approximately 10-13% of the human methylome. For each platform - restriction-enzyme based enhanced reduced representation (ERRBS), capture based Agilent SureSelect Methyl-seq (SSMethylseq), and capture based Roche NimbleGen SeqCap Epi CpGiant (CpGiant) - we used human lung fibroblast cell line IMR90 DNA to make libraries according to each protocol and sequenced to equivalent depth. Overall, SSMethylSeq and CpGiant covered >95% of their designed capture regions whereas ERRBS covered 70% of its expected MspI regions. Methylation levels were concordant across the platforms. The concordance of annotations of CpG units for genomic features, displayed roughly the same proportions of genomic features. SSMethylSeq and CpGiant are most similar and cover marginally more annotated regions than ERRBS. However, the number of CpG units shared by all methods was low, ~26% of any platform. We conclude that captured based methods are largely consistent in terms of covered CpG loci although ERRBS provides comparable data at a significantly reduced price. Furthermore, library preparation for ERRBS can be performed with as little as 75ngs of starting material, whereas micrograms are needed for the capture hybridization techniques. Libraries were made from human lung fibroblast cell line IMR90 DNA for each protocol of ERRBS, Agilent SureSelect Methyl-seq, Roche NimbleGen SeqCap Epi CpGiant, and WGBS, then sequenced as paired-end 100bp on an Illumina HiSeq 2500.

Dataset Information

Promoter capture-C of primary HepG2 cells

Publications

Genome-scale Capture C promoter interactions implicate effector genes at GWAS loci for bone mineral density.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure