Anatomical and molecular dissection of the prestreak chick embryo
Ontology highlight
ABSTRACT:
INSTRUMENT(S): NextSeq 500
ORGANISM(S): Gallus gallus
SUBMITTER: Claudio Stern
PROVIDER: E-MTAB-7941 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:We performed a detailed analysis of gene expression in the 2-day (HH12) embryonic chick heart. RNA-seq of 13 microdissected heart regions reveals regionalised expression of about 15,000 genes (Dataset 1). Of these, 131 genes that are differentially expressed (FPKM ≥20, fold change ≥1.1-4.0) within a region compared to the other 12 regions were studied by in situ hybridisation (bold text in Dataset 1) and used to generate a 3D molecular map of the heart at this stage of development.
2019-10-02 | E-MTAB-7663 | biostudies-arrayexpress
Project description:We used NEBNext Ultra Directional RNA Library Prep Kits to prepare RNA-seq libraries of total RNA from hnRNP A2/B1 and A1 depleted A549 cells. Pro-seq libraries were prepared from A549 cells using Illumina adapters hnRNP A2/B1 and A1 depleted A549 cells were generated by lentiviral infections of shRNA constructs. RNAs were isolated using Trizol.
2016-05-17 | E-GEOD-76151 | biostudies-arrayexpress
Project description:During early vertebrate development, signals from a special region of the embryo, the organizer, can re-direct the fate of non-neural ectoderm cells to form a complete, patterned nervous system. This is called neural induction and has generally been imagined as a single signaling event, causing a switch of fate. Here we undertake a comprehensive analysis, in very fine time-course, of the events following exposure of ectoderm to the organizer. Using transcriptomics and epigenomics we generate a Gene Regulatory Network comprising 175 transcriptional regulators and 5,614 predicted interactions between them, with fine temporal dynamics from initial exposure to the signals to expression of mature neural plate markers. Using in situ hybridization, single-cell RNA-sequencing and reporter assays we show that neural induction by a grafted organizer mimics normal neural plate development. The study is accompanied by a comprehensive resource including information about conservation of the predicted enhancers in different vertebrate systems.
2023-03-14 | E-MTAB-10424 | biostudies-arrayexpress
Project description:Mammalian spermatogenesis is a complex biological process that occurs within a highly organized tissue, the seminiferous epithelium. The coordinated maturation of spermatogonia, spermatocytes and spermatids suggests the existence of precise programs of gene expression in these cells as well as in their neighboring somatic Sertoli cells. The objective of this study was to elucidate genes encoding the proteins that execute these programs. Rat seminiferous tubules at stages I, II-III, IV-V, VI, VIIa,b, VIIc,d, VIII, IX-XI, XII, XIII-XIV of the cycle were isolated by microdissection and Sertoli cells, spermatogonia plus early spermatocytes, pachytene spermatocytes and spermatids were purified from enzymatically-dispersed testes. Microarray analysis using Rat Genome 230 2.0 arrays identified a total of 16,971 probe sets that recognized transcripts. A comparison with the transcriptome of other tissues identified 398 testis-specific probe sets, which therefore are potential targets for the development of new contraceptives. Sequential waves of cell and stage-specific gene expression are associated with progression of germ cells through the stages of the cycle of the seminiferous epithelium and 1612 probe sets recognized transcripts whose expressions varied at least 4-fold across the stages of the cycle. Pathway analyses reveal that entire biological processes are regulated cyclically in testicular cells. Important among these are cell cycle and DNA repair. Thus, stage-specific gene expression is a widespread and fundamental characteristic of spermatogenic cells and Sertoli cells. Experiment Overall Design: Seminiferous tubules at the following stages or groups of stages were isolated by transillumination-assisted microdissection: I, II-III, IV-V, VI, VIIa,b, VIIc,d, VIII, IX-XI, XII, XIII-XIV. Twenty-five segments of tubules, 2 m in length, were collected at each stage or group of stages from each rat. Tubules from two separate animals were pooled to form one sample from each stage or groups of stages. A total of 5 independent samples per stage or groups of stages were analyzed. Mature Sertoli cells were isolated to about 85% purity (n=4). Three groups of germ cells were isolated by centrifugal elutriation from enzyme-dispersed testes: round spermatids (n=4), pachytene spermatocytes (n=4) and spermatogonia plus early spermatocytes (n=3) . Purity of these cells has been shown to vary between 85% to 95%
2008-06-20 | E-GEOD-8978 | biostudies-arrayexpress
Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5â?² and 3â?² untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5â?² untranslated regions exert robust translational control between cell lines, while 3â?² untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).
2016-01-11 | E-GEOD-69352 | biostudies-arrayexpress
Project description:During early vertebrate development, signals from a special region of the embryo, the organizer, can re-direct the fate of non-neural ectoderm cells to form a complete, patterned nervous system. This is called neural induction and has generally been imagined as a single signaling event, causing a switch of fate. Here we undertake a comprehensive analysis, in very fine time-course, of the events following exposure of ectoderm to the organizer. Using transcriptomics and epigenomics we generate a Gene Regulatory Network comprising 175 transcriptional regulators and 5,614 predicted interactions between them, with fine temporal dynamics from initial exposure to the signals to expression of mature neural plate markers. Using in situ hybridization, single-cell RNA-sequencing and reporter assays we show that neural induction by a grafted organizer mimics normal neural plate development. The study is accompanied by a comprehensive resource including information about conservation of the predicted enhancers in different vertebrate systems.
2023-03-14 | E-MTAB-10420 | biostudies-arrayexpress
Project description:In order to understand molecular basis of cardiac ageing in killifish, we have performed RNA Seq on the ventricular regions of young and aged killifish. Experiment was performed in biological triplicates.
2019-03-22 | E-MTAB-7582 | biostudies-arrayexpress
Project description:This experiment intended to define differential gene expression between germinal center B cells expressing or not the Wiskott-Aldrich syndrome protein in mice. Sequencing was obtained on an Illumina HiSeq2500 system from Dark Zone GCB (DAPI-CD19+ GL7+IgD-CXCR4highCD86low) purified from CTL and GCBcWKO mice (n=4).
2021-06-01 | E-MTAB-10056 | biostudies-arrayexpress
Project description:Early onset urticarial rash with systemic inflammatory symptoms are hallmarks of hereditary autoinflammatory diseases caused by gene mutations of the innate immune pathway, e.g. nucleotide receptor protein 3 (NLRP3). However, in many cases genetic tests are negative, suggesting the existence of unrecognized genetic variants. Here, we report a four-generation family with cold-induced urticarial rash, arthralgia, chills, headache and malaise associated with an autosomal-dominant inheritance. Genetic studies identified a novel substitution mutation in gene F12 (T859A, resulting in p.W268R) which encodes coagulation factor XII (FXII). Occurrence of the mutation segregated with disease status. Functional studies revealed fragmentation and spontaneous activation of FXII in patient plasma and supernatant of HEK293 cells transfected with recombinant W268R-mutated proteins. Furthermore, we observed contact system activation with reduced plasma prekallikrein and profound cleavage of high molecular weight kininogen, representing bradykinin production. As a local source of FXII, skin and blood neutrophils were identified. Interleukin-1ß (IL-1ß) was upregulated in lesional skin and in mononuclear donor cells exposed to recombinant mutant proteins. In accordance with these findings, treatment with icatibant (bradykinin-B2-antagonist) or anakinra (interleukin-1-antagonist) reduced disease activity in patients. Thus, we identified anovel autoinflammatory syndrome characterized by a substitution in the F12 gene resulting in activation of the contact system and cytokine-mediated inflammation.
2010-01-10 | PXD016341 | Pride
Project description:This RNA sequencing experiment is part of the study \\"Preclinical animal model of Diamond-Blackfan anemia with single amino acid mutation of ribosomal protein Rps19\\". A mouse model with conserved arginine 67 deletion of ribosomal protein Rps19 mutation develops features characteristic of human Diamond-Blackfan anemia, a rare bone marrow failure syndrome, including hematologic dysfunctions, early onset growth delay, intrinsic anemia, severe craniofacial, skeletal, urogenital, cardiovascular, and cerebral abnormalities leading to premature lethality during the adolescence of the mouse. This DBA mouse model exhibits cell intrinsic activation of the Trp53 signaling pathway in hematopoietic stem cells (HSCs) leading to reduced erythroid lineage development that may be rescued after inactivation of the tumor suppressor Trp53. The E14.5 fetal liver transcriptome analysis study confirms the involvement of non-canonical components of the p53 signaling pathway in the etiopathogenesis of DBA, manifested already during fetal development, consistent with the early onset of DBA-like phenotypes in mouse embryos as well as development of the disease in neonatal human patients. These results confirm our previous findings in adult hematopoietic progenitors as well as indicate that the development of DBA occurs well into the fetal development in both humans and our mouse model.
2023-05-31 | E-MTAB-12448 | biostudies-arrayexpress