TRPM2-AS promotes the malignancy of osteosarcoma cells by targeting miR-15b-5p/PPM1D axis.
Ontology highlight
ABSTRACT:
SUBMITTER: Cai Y
PROVIDER: S-EPMC8973373 | biostudies-literature | 2022 Apr
REPOSITORIES: biostudies-literature
Publications
TRPM2-AS promotes the malignancy of osteosarcoma cells by targeting miR-15b-5p/PPM1D axis.
Cai Yingchun Y Yang Yudan Y Zhang Xudong X Ma Qingqing Q Li Mengyi M
Cell cycle (Georgetown, Tex.) 20220131 8
Osteosarcoma (OS) is a malignant tumor with a low survival rate and a high incidence rate worldwide. Although research has reported the involvement of long non-coding RNAs (lncRNAs) in the pathogenesis of OS cells, the role of TRPM2-AS, miR-15b-5p, and PPM1D in OS progression remains unclear. This study aimed to examine the interaction of the TRPM2-AS/miR-15b-5p/PPM1D axis in OS cells to gain new insights into the molecular mechanism and pathogenesis of OS. After performing <i>in vitro</i> funct ...[more]
Similar Datasets
Project description:BackgroundNon-small cell lung cancer (NSCLC) is the most common tumor with severe morbidity and high mortality. Long non-coding RNAs (lncRNAs) as crucial regulators participate in multiple cancer progressions. However, the role of lncRNA MEG8 in the development of NSCLC remains unclear. Here, we aimed to investigate the effect of lncRNA MEG8 on the progression of NSCLC and the underlying mechanism.MethodsCell proliferation was analyzed by EdU assays. The impacts of lncRNA MEG8, miR-15a-5p, and miR-15b-5p on cell invasion and migration of NSCLC were assessed by transwell assay. The luciferase reporter gene assay was performed using the Dual-luciferase Reporter Assay System. The effect of lncRNA MEG8, miR-15a-5p, and miR-15b-5p on tumor growth was evaluated in nude mice of Balb/c in vivo.ResultsWe revealed that the expression levels of MEG8 were elevated in the NSCLC patient tissues compared to that in adjacent normal tissues. The expression of MEG8 was negatively relative to that of miR-15a-5p and miR-15b-5p in the NSCLC patient tissues. The expression of MEG8 was upregulated, while miR-15a-5p and miR-15b-5p were downregulated in NSCLC cell lines. The depletion of MEG8 inhibited NSCLC cell proliferation, migration, and invasion in vitro. MEG8 contributed to NSCLC progression by targeting miR-15a-5p/miR-15b-5p in vitro. LncRNA MEG8 contributes to tumor growth of NSCLC via the miR-15a/b-5p/PSAT1 axis in vivo. Thus, we concluded that lncRNA MEG8 promotes NSCLC progression by modulating the miR-15a/b-5p/PSAT1 axis.ConclusionsOur findings demonstrated that lncRNA MEG8 plays a critical role in NSCLC development. LncRNA MEG8, miR-15a-5p, miR-15b-5p, and PSAT1 may serve as potential targets for NSCLC therapy.
| S-EPMC7852147 | biostudies-literature
Project description:BackgroundAnti-angiogenic therapy has become one of the effective treatment methods for tumors. Long noncoding RNAs (lncRNAs) are emerging as important regulators of tumorigenesis and angiogenesis in EC. However, the underlying mechanisms of lncRNA TRPM2-AS in EC are still not clear.MethodsWe screened the differently expressed lncRNAs that were highly associated with poor prognosis and angiogenesis of EC by bioinformatics analysis, and constructed a ceRNA network based on the prognostic lncRNAs. The subcellular localization of TRPM2-AS was determined by fluorescence in situ hybridization (FISH) and nuclear cytoplasmic fractionation assay. CCK-8, EdU, transwell, western blot, qRT-PCR and endothelial tube formation assay were used to evaluate the effects of TRPM2-AS on the proliferation, invasion, migration of EC cells and angiogenesis. The targeted microRNA (miRNA) of TRPM2-AS was predicted by bioinformatic methods. The interaction between TRPM2-AS and miR497-5p, miR497-5p and SPP1 were analyzed by RNA immunoprecipitation and dual-luciferase reporter assay. A subcutaneous tumor model was used to explore TRPM2-AS's function in vivo. CIBERSORT was used to analyze the correlation between TRPM2-AS and immune cell immersion in EC.ResultsWe found that the expression of TRPM2-AS and SPP1 was aberrantly upregulated, while miR-497-5p expression was significantly downregulated in EC tissues and cells. TRPM2-AS was closely correlated with the angiogenesis and poor prognosis in EC patients. Mechanistically, TRPM2-AS could sponge miR-497-5p to release SPP1, thus promoting the proliferation, invasion and migration of EC cells and angiogenesis of HUVECs. Knockdown of TRPM2-AS in xenograft mouse model inhibited tumor proliferation and angiogenesis in vivo. In addition, TRPM2-AS plays a vital role in regulating the tumor immune microenvironment of EC, overexpression of TRPM2-AS in EC cells stimulated the polarization of M2 macrophages and angiogenesis through secreting SPP1 enriched exosomes.ConclusionThe depletion of TRPM2-AS inhibits the oncogenicity of EC by targeting the miR-497-5p/SPP1 axis. This study offers a better understanding of TRPM2-AS's role in regulating angiogenesis and provides a novel target for EC treatment.
| S-EPMC11218065 | biostudies-literature
Project description:MicroRNAs (miRNAs) can participate in many behaviors of various tumors. Prior studies have reported that miR-15b-5p in different tumors can either promote or inhibit tumor progression. In breast cancer, the role of miR-15b-5p is unclear. The main objective of this paper is to explore miR-15b-5p effects and their mechanisms in breast cancer using both in vitro and in vivo experiments. This study showed that miR-15b-5p expression was upregulated in breast cancer compared with normal breast tissue and was positively correlated with poor overall survival in patients. Knockdown of miR-15b-5p in MCF-7 and MD-MBA-231 breast cancer cells restrained cell growth and invasiveness and induced apoptosis, whereas overexpression of miR-15b-5p achieved the opposite effects. We next revealed a negative correlation between miR-15b-5p and heparanase-2 (HPSE2) expression in breast cancer. Knockdown of miR-15b-5p significantly increased HPSE2 expression at both mRNA and protein levels in breast cancer cells in vitro. The underlying mechanisms of miR-15-5p in breast cancer were investigated using luciferase activity reporter assay and rescue experiments. In addition, miR-15b-5p knockdown significantly inhibited tumor growth in a xenograft model in mice. In summary, we showed that miR-15b-5p promotes breast cancer cell proliferation, migration, and invasion by directly targeting HPSE2. Accordingly, miR-15b-5p may serve both as a tool for prognosis and as a target for therapy of breast cancer patients.
| S-EPMC7054484 | biostudies-literature
Project description:Background: We have previously found that circ0085539/miR-526b-5p axis participated in the progression of osteosarcoma (OS). We have been interested in expanding the networking involving circ0085539 and miR-526-5p. We identified another critical downstream target of this axis, pleckstrin homology-like domain family A member 1 (PHLDA1), thus intending to uncover the interaction between the axis and PHLDA1. Methods: Live imaging of mice tumor xenografts was conducted. Immunohistochemistry (IHC) and H&E staining were performed for our in vivo experiment, while the CCK-8 assay, flow cytometry, wound healing, Transwell invasion, and clone formation were employed to assess cellular biological functions. Results: Circ0085539 was first found to be upregulated in osteosarcoma tissues and cell lines, and circ0085539 knockdown obviously suppressed proliferation and induced apoptosis. Subsequently, miR-526b-5p functionally attenuated the tumor suppressive effects induced by circ0106714 silencing on OS cells. PHLDA1 silencing significantly led to proliferation suppression, apoptosis induction, as well as the inhibition of migration, invasion, and colony formation capabilities in OS cells, which also could be restored by the miR-526b-5p inhibitor. Conclusion: Taken together, circ0085539 effectively promoted progression of osteosarcoma through sponging miR-526b-5p to release PHLDA1, strongly suggesting that in vivo intervention of circ0085539-miR-526b-5p-PHLDA1 axis could function as a promising OS-targeted therapy.
| S-EPMC7479240 | biostudies-literature
Project description:Neuroblastoma (NB) is the most common extracranial solid malignancy in children. Despite current aggressive treatment regimens, the prognosis for high-risk NB patients remains poor, with the survival of less than 40%. Amplification/stabilization of MYCN oncogene, in NB is associated with a high risk of recurrence. Thus, there is an urgent need for novel therapeutics. The deregulated expression of microRNA (miR) is reported in NB; nonetheless, its effect on MYCN regulation is poorly understood. First, we identified that miR-15a-5p, miR-15b-5p, and miR-16-5p (hereafter miR-15a, miR-15b or miR-16) were down-regulated in patient-derived xenografts (PDX) with high MYCN expression. MiR targeting sequences on MYCN mRNA were predicted using online databases such as TargetScan and miR database. The R2 database, containing 105 NB patients, showed an inverse correlation between MYCN mRNA and deleted in lymphocytic leukemia (DLEU) 2, a host gene of miR-15. Moreover, overexpression of miR-15a, miR-15b or miR-16 significantly reduced the levels of MYCN mRNA and N-Myc protein. Conversely, inhibiting miR dramatically enhanced MYCN mRNA and N-Myc protein levels, as well as increasing mRNA half-life in NB cells. By performing immunoprecipitation assays of argonaute-2 (Ago2), a core component of the RNA-induced silencing complex, we showed that miR-15a, miR-15b and miR-16 interact with MYCN mRNA. Luciferase reporter assays showed that miR-15a, miR-15b and miR-16 bind with 3'UTR of MYCN mRNA, resulting in MYCN suppression. Moreover, induced expression of miR-15a, miR-15b and miR-16 significantly reduced the proliferation, migration, and invasion of NB cells. Finally, transplanting miR-15a-, miR-15b- and miR-16-expressing NB cells into NSG mice repressed tumor formation and MYCN expression. These data suggest that miR-15a, miR-15b and miR-16 exert a tumor-suppressive function in NB by targeting MYCN. Therefore, these miRs could be considered as potential targets for NB treatment.
| S-EPMC6944109 | biostudies-literature
Project description:BackgroundHeat shock protein 27 (HSP27) is overexpressed during pulmonary fibrosis (PF) and exacerbates PF; however, the upregulation of HSP27 during PF and the therapeutic strategy of HSP27 inhibition is not well elucidated.MethodsWe have developed a mouse model simulating clinical stereotactic body radiotherapy (SBRT) with focal irradiation and validated the induction of RIPF. HSP25 (murine form of HSP27) transgenic (TG) and LLC1-derived orthotropic lung tumor models were also used. Lung tissues of patients with RIPF and idiopathic pulmonary fibrosis, and lung tissues from various fibrotic mouse models, as well as appropriated cell line systems were used. Public available gene expression datasets were used for therapeutic response rate analysis. A synthetic small molecule HSP27 inhibitor, J2 was also used.ResultsHSP27 expression with its phosphorylated form (pHSP27) increased during PF. Decreased mRNA expression of SMAD-specific E3 ubiquitin-protein ligase 2 (Smurf2), which is involved in ubiquitin degradation of HSP27, was responsible for the increased expression of pHSP27. In addition, increased expression of miRNA15b was identified with decreased expression of Smurf2 mRNA in PF models. Inverse correlation between pHSP27 and Smurf2 was observed in the lung tissues of PF animals, an irradiated orthotropic lung cancer models, and PF tissues from patients. Moreover, a HSP27 inhibitor cross-linked with HSP27 protein to ameliorate PF, which was more effective when targeting the epithelial to mesenchymal transition (EMT) stage of PF.ConclusionsOur findings identify upregulation mechanisms of HSP27 during PF and provide a therapeutic strategy for HSP27 inhibition for overcoming PF.
| S-EPMC9824921 | biostudies-literature
Project description:MiR-193a-5p has been observed to have oncogenic or tumor suppressive functions in different kinds of cancers, but its role and molecular mechanism in osteosarcoma are elusive. Na+/Ca2+ exchangers (NCX1, NCX2 and NCX3) normally extrude Ca2+ from the cell, and deregulation of the intracellular Ca2+ homeostasis is related to several kinds of diseases, including cancer. The present study demonstrated that miR-193a-5p was upregulated in osteosarcoma tissues compared with the corresponding adjacent noncancerous tissues, and promoted colony formation, migration, invasion and epithelial-mesenchymal transition (EMT) in osteosarcoma cells (SaOS-2 and U-2OS), as well as metastasis in a murine xenograft model. Tandem mass tag-based quantitative proteomics analysis identified NCX2 as a potential target of miR-193a-5p. Luciferase activity assays and Western blotting further confirmed that miR-193a-5p recognized the 3'-untranslated region of NCX2 mRNA, and negatively regulated NCX2 expression. NCX2 was downregulated in osteosarcoma tissues, and its expression was negatively correlated with miR-193a-5p levels. Ectopic expression of NCX2 in osteosarcoma cells could reverse the oncogenicity of miR-193a-5p, indicating that miR-193a-5p exerted its effects by targeting NCX2. Further study demonstrated that NCX2 suppresses Ca2+-dependent Akt phosphorylation by decreasing intracellular Ca2+ concentration, and then inhibited EMT process. Treatment with the antagomir against miR-193a-5p sensitized osteosarcoma to the Akt inhibitor afuresertib in a murine xenograft model. In conclusion, a miR-193a-5p/NCX2/AKT signaling axis contributes to the progression of osteosarcoma, which may provide a new therapeutic target for osteosarcoma treatment.
| S-EPMC8408106 | biostudies-literature
Project description:BackgroundSome recent studies have reported the role of circular RNAs (circRNAs) in modulating the tumorigenesis of human malignancies. Nevertheless, the expression characteristics, biological functions, and regulatory mechanism of circ_0000189 in glioma are unclear.MethodsQuantitative real-time polymerase chain reaction (qRT-PCR) was utilized to detect the expression levels of circ_0000189, miR-192-5p, and ZEB2 mRNA in glioma tissues and cells. The association between the expression of circ_0000189 and the clinicopathological indicators and the features of magnetic resonance imaging (MRI) images of glioma patients were analyzed. Western blot was utilized to evaluate ZEB2 expression and epithelial-mesenchymal transition (EMT-)-related proteins (E-cadherin, N-cadherin, as well as Vimentin) in glioma cells. Cell proliferation was assessed employing cell counting kit-8 (CCK-8) and EdU experiments. Flow cytometry was used to detect the apoptotic rate of the cells. Cell migration and invasion were accessed employing Transwell assay. Moreover, dual luciferase reporter gene assay and RNA immunoprecipitation assay were employed to investigate the targeting relationship between miR-192-5p and circ_0000189, miR-192-5p, and ZEB2. Subcutaneous tumorigenesis experiment and lung metastasis experiment in nude mice were conducted to verify the regulatory function of circ_0000189 on the proliferation and metastasis of glioma cells in vivo.Resultscirc_0000189 was markedly overexpressed in glioma tissues and cell lines. Its high expression was associated with poor clinical pathological indicators and adverse MRI signs. Gain-of-function experiments and loss-of-function experiments confirmed that circ_0000189 overexpression facilitated the proliferation and migration, as well as invasion of glioma cells, and suppressed apoptosis, and facilitated epithelial-mesenchymal transition (EMT) process. Compared to the control group, knocking down circ_0000189 suppressed the malignant phenotypes of glioma cells both in vivo and in vitro. Working as a competitive endogenous RNA, circ_0000189 directly targeted miR-192-5p, and repressed its expression, and circ_0000189 positively modulated ZEB2 expression indirectly via repressing miR-192-5p.Conclusioncirc_0000189 facilitates the progression of glioma by modulating miR-192-5p/ZEB2 axis.
| S-EPMC9526621 | biostudies-literature
Project description:Following the publication of this article, an interested reader drew to the authors' attention that the primer sequences written for lncRNA DQ786243 and miR‑15b‑5p on p. 2 in the study were incorrect. Upon requesting an explanation of these errors from the authors, they realized that, regarding the sequence of the reverse primer for lncRNA DQ786243, three nucleotides were omitted from its 3'‑end [the sequence of this primer on p. 2, right‑hand column, line 25 should have been written as 5'‑CTTCTGCTGGGCTGTTGAGTG‑3' (with the omitted nucleotides highlighted in bold)]. Regarding the primers of miR‑15b‑5p, the authors used the mature miR‑15b‑5p sequence as the forward primer; however, they inadvertently overlooked replacing U with T in the description of the forward primer of miR‑15b‑5p, and therefore the sequence of the forward primer of miR‑15b‑5p on line 27 should have been written as 5'‑TAGCAGCACATCATGGTTTACA‑3'. Moreover, a universal reverse primer was used for the reverse primer of miR‑15b‑5p, as provided by the kit [specifically, the authors used an Mir‑X miRNA qRT‑PCR TB Green Kit (Takara Bio USA, Inc.) for detecting the expression of miR‑15b‑5p, and the reverse primer was supplied in the kit]; however, a different primer sequence used in the authors' lab was erroneously written as the reverse primer of miR‑15b‑5p in the manuscript. Finally, note that the title was published with a typographical error: "miR‑15p‑5p" in the title should have been written as "miR‑15b‑5p", as appeared elsewhere throughout the paper, and the corrected title is presented above. The authors are grateful to the Editor of Molecular Medicine Reports for allowing them the opportunity to publish this corrigendum, and all the authors agree with its publication. The authors also regret the inconvenience that these mistakes have caused. [Molecular Medicine Reports 23: 318, 2021; DOI: 10.3892/mmr.2021.11957].
| S-EPMC9813549 | biostudies-literature
Project description:Osteosarcoma is one of the commonest metastatic tumor in children and teenagers, and has a hopeless, prognosis. Long non-coding RNA (lncRNA) acts momentous roles as a regulator on the proliferation and migration of cancer. Here, we performed GEO database analysis and qPCR to identify differentially expressed lncRNAs in osteosarcoma cells. Knockdown of lncRNA LINC01140 was used to detect the effect of LINC01140 on the proliferation, invasion, and epithelial-mesenchymal transition (EMT) of osteosarcoma cells. Bioinformatics analysis and qPCR identified the LINC01140/miR-139-5p/Homeobox A9 (HOXA9) regulatory axis. RNA immunoprecipitation assay, Dual-luciferase assay, and rescue experiments confirmed the interaction of LINC01140/miR-139-5p/HOXA9 in osteosarcoma. LINC01140 was overexpressed in osteosarcoma and knocking down LINC01140 restrained the proliferation and invasion of osteosarcoma cells and EMT. In Saos2 and MG63 cells, LINC01140 sponged miR-139-5p, and a miR-139-5p inhibitor overturned the suppression of LINC01140 knockdown on the proliferation and migration of osteosarcoma cells. Moreover, miR-139-5p depressed the invasion, proliferation, and EMT of osteosarcoma cells via targeting HOXA9. Our results indicate that LINC01140 downregulation inhibits the invasion, proliferation, and EMT in osteosarcoma cells through targeting the miR-139-5p/HOXA9 axis. Therefore, LINC01140 is a potential therapeutic target for osteosarcoma.
| S-EPMC9253409 | biostudies-literature