MIMt-28S- A new 28S reference database for taxonomic assignment of metagenomic samples

ABSTRACT: MIMt-28S is a database composed by sequences belonging to Eukaryotes from Target Loci type material, Refseq genomes and Genbank genomes. To create MIMt-28S database we collected all the 28S curated sequences from Target Loci and we append the 28S region (eukaryote large subunit rRNA) from all the available genomes in RefSeq predicted with the tool Infernal 1.1.5. The result is a complete database where most of the sequences are manually curated from RefSeq curators and are properly identified at species level, or even subspecies/strain. The full version of MIMt-28S contains in addition 28S regions from the genome of new species deposited in Genbank, always keeping the full 28S region and identifying exactly the species name to get the full taxonomic classification. Thus, all sequences included in both versions of MIMt-28S are full length large subunit rRNA and are well identified at all taxonomic levels. MIMt-28S has been trained to be used in QIIME and the classifier is also provided. The database format is >SeqIDK__kingdom;P__phylum;C__class;O__order;F__family;G__genus;S__Genus_species CGCGACTACGACTACGCTCAGACGCATCGTACGCAGACTACGTCAGTCAGACGTCGCTGCTCGTCGTACGTACGCT There is also available a file with just the taxonomy associated to each sequence in the format: SeqIDFull_taxonomy and another one with species sharing the 100% of the sequence, so the programs could not differentiate between both species when a taxonomic classification is performed. All files are available for both, only curated version and full version (including also predicted 28S regions from Genbank genomes)

ORGANISM(S): Eukaryotes

SUBMITTER:  

PROVIDER: S-BSST2015 | biostudies-other |

REPOSITORIES: biostudies-other