VEGFB treated macrophage
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
PROVIDER: GSE27479 | GEO | 2011/03/01
SECONDARY ACCESSION(S): PRJNA138435
REPOSITORIES: GEO
Similar Datasets
Project description:VEGFB effect in resting and active macrophage. The goal of this study was to investigate the effects of Vascular Endothelial Growth Factor B (VEGFB) on gene expression in resting and active macrophages. Resting macrophages were obtained from peripheral blood of healthy volunteers. A part of macropahges were activated by Lipopolysaccharides (LPS). Both types of cells were treated by VEGFB. Total RNA was extracted using conventional Trizol extraction, quantified by Nanodrop and analyzed by Bioanalyzer. 1microg of RNA was amplified using AminoAllyl MessageAmp kit. 5µg amino allyl-coupled RNA was labeled with Cy3 or Cy5 dyes. Dye coupling yield >5% was a prerequisite for further analysis. 750ng of labeled RNA was hybridized on 25K gene microarrays for 17 hours at 60°C. 4 arrays per sample were hybridized and scanned with the Genepix 4000B Scanner (Molecular Devices). Microarray data quantification and pre-processing was performed with the MAIA software . The SAM tool was applied to identify differentially expressed genes. Macrophages from 2 different volunteers were treated by vehicle, or VEGFB, or LPS, or LPS and VEGFB
2011-03-01 | E-GEOD-27479 | biostudies-arrayexpress
Project description:The goal of this study was to investigate the effects of the cardioprotective nucleoside adenosine on gene expression in early and late endothelial progenitor cells. Adenosine mod Early outgrowth endothelial progenitor cells were obtained by adhesion of peripheral blood mononuclear cells of healthy volunteers. Late endothelial progenitor cells were obtained by purification of CD34+ peripheral blood cells and were cultured and amplified in endothelial-specific medium containing growth factors. Both cell types were treated by adenosine (10micromol/L) for 6 hours. Total RNA was extracted using conventional Trizol extraction, quantified by Nanodrop and analyzed by Bioanalyzer. 1microg of RNA was amplified using AminoAllyl MessageAmp kit. 5µg amino allyl-coupled RNA was labeled with Cy3 or Cy5 dyes. Dye coupling yield >5% was a prerequisite for further analysis. 750ng of labeled RNA was hybridized on 25,000 gene microarrays for 17 hours at 60°C. 4 arrays per sample were hybridized and scanned with the Genepix 4000B Scanner (Molecular Devices). Six independent experiments were performed. Microarray data quantification and pre-processing was performed with the MAIA software and intensity values were log-transformed. Gene expression values were standardized across experiments with mean = 0 and standard deviation = 1. The SAM tool was applied to identify differentially expressed genes.
2011-01-29 | E-GEOD-26744 | biostudies-arrayexpress
Project description:Human umbilical vein endothelial cells (HUVEC) were cultivated on 1%-gelatin-coated 75-cm2 culture flasks in Medium 200 supplemented with 2% fetal calf serum, penicillin (100 units/ml), streptomycin (100 units/ml) and Funizone (0.25 μg/ml) supplied by Cascade Biologics (Portland, OR). Prior to an experiment, HUVECs were subcultivated with Trypsin/EDTA onto 1% gelatin coated glass 30-mm glass coverslips in 60 mm glass Petri dishes. The hypoxic treatment was performed in airtight chambers from Mitsubishi Gas Chemical Co. Inc (Remel Scientific, Baton Rouge, LA) Preconditioning consisted of 1-hour hypoxia followed by various periods of reoxygenation (0, 3, 5, 12 and 24 hrs) for gene expression analysis. Total RNA was extracted from cultured HUVECs with TRITM reagent according to the manufacture’s instructions (Molecular Research Center, Cincinnati, OH). Cy5 and Cy3 labeled cDNA probes were generated from total RNA by reverse transcription in the presence of aminoallyl-dUTP according to the method described by Xiang, et al,15. Human universal reference RNA (Stratagene, La Jolla, CA) was Cy3-labeled and used as reference RNA and RNA isolated from HUVEC at 0, 3, 5, 12 and 24 hour following reoxygenation were Cy5-labeled. The high-resolution scans of hybridized microarrays were acquired with a GenePix scanner 4000B (Axon Instruments, Inc., Union City, CA) and tabulated with GenePix pro 5.1 software. Keywords: time-course
2004-02-18 | GSE1041 | GEO
Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do).
2012-08-23 | GSE39572 | GEO
Project description:Total RNA was extracted from skin biopsies before and after imatinib (Gleevec) treatment using Qiagen RNeasy fibrous tissue kit. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. Amplified skin RNA (labeled with Cy5) and amplified Stratagene Human Universal Reference RNA (labeled with Cy3) were competitively hybridized to HEEBO microarrays in duplicate as described (http://www.microarray.org/sfgf/heebo.do). 161a/b: Patient 1, pre-Gleevec treatment 170a/b: Patient 1, post-Gleevec treatment 215a/b: Patient 2, pre-Gleevec treatment 232a/b: Patient 2, post-Gleevec treatment A compound treatment design type is where the response to administration of a compound or chemical (including biological compounds such as hormones) is assayed. Compound Based Treatment: Treated with 100 mg Gleevec twice daily for 3 months or 200 mg Gleevec daily for 6 months Keywords: compound_treatment_design
2009-03-31 | GSE11130 | GEO
Project description:RNA from adult mosquitoes was aminoallyl-labelled and directly hybridized to glass high density microarrays. Intensity values are used in a study of detection of transcription above background. Keywords: High density oligonucleotide array; detection of gene transcription
2006-07-15 | GSE5196 | GEO
Project description:Mice were intranasally instilled at 6 weeks of age with silica, titanium dioxide, or saline control and macrophages were harvested by broncho-alveolar lavage at 14 weeks of age. RNA was isolated using RNeasy Mini kits (Qiagen). Due to low yield of RNA, mRNA was amplifed by RiboAmp kits (Arcturus) and resulting aRNA was indirectly labeled with Alexa-Fluor 647 dye (Molecular Probes). This was hybridized against Universal Mouse Reference RNA (Stratagene) which was indirectly labeled with Alexa-Fluor 555 dye (Molecular Probes). Slides were printed in house using PCR product cDNA targets on GAPS slides (Corning). Slides were scanned with an Axon GenePix 4000B scanner and data was analyzed using GenePix Pro 4.0 software and Iobion GeneTraffic Duo software. Data was normalized to a total 1:1 ratio of read to green dye. Keywords: parallel sample
2005-02-18 | GSE2279 | GEO
Project description:Eight “self-self” hybridizations were prepared as follows. Total RNA was isolated from each of three rat livers and brains, and equal mass amounts of each of these six samples were combined to create a mixed RNA population. Cy3- and Cy5-labeled cDNA was generated from this RNA mixture using an aminoallyl nucleoside analog indirect labeling protocol. Specifically, eight separate 20 microgram aliquots of the total RNA mixture were reverse transcribed into cDNA in the presence of aminoallyl-dUTP and the resulting cDNA was then coupled to either Cy3 or Cy5 mono NHS ester (four reactions with each label). Keywords: Self-Self Hybridization
2007-09-11 | GSE8950 | GEO
Project description:Ten male 4get mice were infected with N. brasiliensis and single-cell suspensions of total lung tissue were prepared 9 days after infection. Cells were stained for CD3, CD19, c-kit and CCR3 and sorted for CD3-CD19-c-kit-GFP+CCR3+SSChi (eosinophils) and CD3-CD19-c-kit- GFP+CCR3-SSClo (basophils) using a MoFlo high-speed cell sorter (Cytomation, Fort Collins, CO). Total RNA was isolated from 2 x 106 eosinophils and 1.75 x 105 basophils using the Total RNA Isolation Kit (Fluka, Buchs, Switzerland) and amplified by two rounds of in vitro transcription using the Amino Allyl MessageAmpTM aRNA kit (Ambion, Austin, TX). Universal Mouse Reference RNA (#740100; Stratagene, La Jolla, CA) was amplified in the same way. Aminoallyl-UTP was incorporated during the second round of amplification and 5 µg of amplified RNA was coupled to Cy3 and Cy5 fluorescent dyes (CyScribeTM dye labeling kit, Amersham Biosciences, Peapack, NJ). Probes were hybridized to spotted glass oligonucleotide (70-mer) arrays which cover just over 16,400 unique genes (Mouse Genome Set Version 2.0, Qiagen, Germany). The arrays were prehybridized in 1% BSA (Invitrogen), 5 x SSC, 0.1% SDS for 2 hr at 42°C, washed in water and hybridized with the Cy3/Cy5-labeled probes in 2.8 x SSC, 0.2% SDS, 0.6 mg/ml Cot-1 DNA (Invitrogen), and 0.8 mg/ml yeast tRNA, at 63°C for 45 hr. Slides were washed sequentially in 0.03%SDS/1 x SSC, 0.2 x SSC and 0.05 x SSC, dried and scanned on an Axon 4000B scanner using Genepix 3.0 software (Axon Instruments, Inc.). Data were normalized using the R package Bioconductor software and ?lowess? normalization on the pixel medians without background subtraction (Ihaka and Gentleman, 1996). Keywords = Eosinophils Keywords = Basophils Keywords = Nippostrongylus Keywords = Lung Keywords = Type 2 immunity Keywords: other
2004-02-21 | GSE984 | GEO
Project description:We analyzed effects of monkeypox (MPX) and vaccinia (VAC) infection on cultured human cells. Our custom-designed arrays contain >18,000 human genes as well as genes for each open reading frame of MPX and VAC. A reference experiement design type is where all samples are compared to a common reference. Compound Based Treatment: Chemical used for treating infected cells Infection: Virus used for infection Cell Line: Cell line used for infection Time: Time cells were harvested after infection Keywords: reference_design Experiments used primary human monocytes with mock infection, VAC-Western Reserve, VAC-NYBOH, MPX-Zaire, gamma irradiated (killed) MPX-Zaire, and Ebola-Zaire (EBOV) (deposited March 2004). The next set of experiments used primary human monocytes (Mf7.29) and primary human fibroblasts (S100) with mock infection, VAC-Western Reserve, MPX-Zaire, and gamma irradiated MPX-Zaire (g-MPX) (deposited August 2004). The final set used primary human monocytes (Mph), primary human fibroblasts (NHDF), and HeLa cells with mock infection, VAC-Western Reserve, MPX-Zaire, and gamma irradiated MPX-Zaire (g-MPX). Some cells were treated with ionomycin + PMA (I+P), cycloheximide (CHX) or hydroxyurea (HU). (deposited November 2005). Total RNA from cells was harvested at each timepoint, preserved in Trizol, Trizol-extracted total RNA, 1 round amplified (Ambion MessageAmp I), directly labeled by Cy5 incorporation during reverse transcription of amplified RNA. Each sample was hybridized versus a common reference (Stratagene Universal Human Reference RNA plus a mix of poxvirus transcripts from all timepoints). The reference was1 round of amplification (Ambion MessageAmp I), directly labeled by Cy3 incorporation during reverse transcription of amplified reference RNA. Cy3 and Cy5 samples were hybridized to a custom human-poxvirus array. Fluorescent images of hybridized microarrays were acquired using the GenePix 4000B and GenePix 4200AL microarray scanners.
2008-07-17 | E-GEOD-11234 | biostudies-arrayexpress