Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Cell cycle motif decoy oligos

ABSTRACT: Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do).

ORGANISM(S): Homo sapiens

PROVIDER: GSE39572 | GEO | 2012/08/23

SECONDARY ACCESSION(S): PRJNA173437

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

Cell cycle motif decoy oligos

Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do). genetic_modification_design

2012-08-23 | E-GEOD-39572 | biostudies-arrayexpress

SF3b155 knock-down by two different siRNA oligos in HeLa cells

Project description:Analysis of the alternative pre-mRNA procesing after SF3b155 siRNA knock-down in HeLa cells employing a custom microarray platform sensitive to splicing. HeLa cells were transfected with either a scrambled RNA or one of the two different SF3b155 siRNA oligonucleotides (oligo 3: 5’-GACAGCAGAUUUGCUGGAUACGUGA-3; oligo 5: 5’-CCCUGUGGCAUUGCUUAAUGAUAU-3’). Total RNA samples from three biological replicates were labeled in direct and dye-swap hybridizations. Labeled samples were hybridized into our custom splicing-sensitive agilent platform which contains 1804 splicing events from 482 genes.

2011-03-08 | E-GEOD-22952 | biostudies-arrayexpress

Expression consequences of decoy vs scrambled oligonucleotides harboring AAAA[AGT]TT motif in MBA-MD-231 cell line

Project description:Dual-color transcriptional profiling of decoy-transfected cells, harboring AAAA[AGT]TT motif, versus scrambled-transfected cells as controls.

2009-11-04 | GSE18844 | GEO

EWS siRNA knock-down in HeLa cell line

Project description:HeLa cell line was trasfected by a EWS siRNA oligo causing knock-down of EWS or a siRNA scrambled oligo

2011-09-20 | GSE22929 | GEO

RIP: miR-202 mimic-transfected HeLa cells vs. negative control

Project description:Potential miR-202 targets were identified using a targetome-wide RIP-based microarray. HeLa cells were transfected with either a miR-202 mimic or a scrambled single-stranded RNA negative control. RNA was isolated from total cell lysate prior to IP and from antibody-immobilized Protein G agarose beads-RNP complexes (post-IP).

2012-12-19 | GSE42981 | GEO

EWS siRNA knock-down in HeLa cell line

Project description:HeLa cell line was trasfected by a EWS siRNA oligo causing knock-down of EWS or a siRNA scrambled oligo Three biological replicates were labeled in direct and dye-swap microarray experiments and hybridized onto an Agilent custom splicing-sensitive microarray platform.

2011-09-19 | E-GEOD-22929 | biostudies-arrayexpress

Differential Gene Up-regulation by HIF-1a and HIF-2a in HEK293T.

Project description:Cell lines. HEK293 human embryonic kidney cells were obtained from ATCC (American Type Culture Collection, Manassas, VA) and were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (Heat inactivated, Hyclone, Logan, Utah) and 1X antibiotics/glutamine (100 units/ml penicillin, 100ug/ml streptomycin, 292ug/ml L-Glutamine sulfate, all from Invitrogen Corp, Carlsbad, CA.), under either hypoxic (1% O2) or normoxic (21% O2) conditions at 37C in a tissue culture incubator. Treatment. Cells treated in hypoxia for 16 hours or transfected with HIF-1a (HIF-1amut or HIF2a) plasmid. At the end of treatment, cells were collected and washed. Microarray studies. Total RNA samples were extracted from HEK293T cells grown in 1% or 21% O2 overnight and from transfected cells. Total RNA (20 µg) from each sample was synthesized into double-stranded cDNA with reverse transcriptase (Fairplay labeling kit, Stratagen, La Jolla, CA) using an oligo d(T) primer. The double stranded cDNA from untreated cells was labeled with Cy3 monofunctional reactive dye and that from hypoxia-treated or transfected cells was labeled with Cy5 monofunctinal reactive dye. The probe was hybridized to a long oligo array (Hs-Operon V2-vB1.1px.gal) containing 20K human transcripts (NCI Microarray Facility, Advanced Technology Center, Gaithersburg, MD) overnight at 42C . The slides were washed and spin-dried. Microarray slides were scanned with a GenePix 4000 microarray scanner (Axon Instruments, Union City, CA.). The microarray images were analyzed with GenePix 3.0 software and data analysis was performed with the MicroArray Database (mAdb) system hosted by the Center for Information Technology and Center for Cancer Research at the NCI. Keywords: other

2005-04-01 | GSE2020 | GEO

RNA-seq analysis of HeLa cells treated with GapmeR antisense oligonucleotides

Project description:The experiment was carried out to provide insights into biological function of a newly identified long noncoding RNA, PNCTR. HeLa cells were transfected with either a PNCTR-specific GapmeR antisense oligonucleotide or a non-targeting GapmeR control. Total RNAs were extracted at 24 hours post transfection, QC'd and hybridized with oligo(dT) magnetic beads to isolate the poly(A) RNA fraction. Stranded mRNA sequencing libraries were then prepared using the Illumina TruSeq Stranded mRNA Library Kit and sequenced using an Illumina HiSeq 2500 instrument.

2018-10-12 | E-MTAB-6529 | biostudies-arrayexpress

Project description:Decoy vs Scrambled and siRNA vs Mock Transfected MBA-MD-231 Cell Line

| PRJNA121129 | ENA

Up- and downregulated genes in GLTP knock-out HeLa cells compared to wildtype HeLa cells.

Project description:The total HeLa cell transcriptome analysis was carried out using Illumina HumanHT-12 v4 Expression BeadChip array. RNA was isolated from cultures of wild-type (Cas9 GLTP control) and three different GLTP gene KO clones. 100 ng of total RNA was primed using oligo-dT(T7) primers and converted to cDNA with Invitrogen SuperScript III Reverse Transcriptase. The double-stranded cDNA template was amplified and labeled with in vitro transcription to generate multiple copies of biotinylated cRNA. Purified biotinylated cRNA was hybridized to HumanHT-12 v4 expression beadchips for 18 h at 58 °C using a rocking platform at speed 5. Beadchips were washed, blocked, stained with streptavidin-Cy3, and scanned with an Illumina iScan scanner, using the manufacturer’s recommended protocols. The raw data were extracted using Illumina’s GenomeStudio software.

2022-08-31 | E-MTAB-12118 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data