Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

SUMOylation study in mascRNA-transfected cells

ABSTRACT: We aimed to characterize changes within the SUMOylation pathway that are driven by the tRNA-like molecule mascRNA. For the experiments otulined below, we used 293FT cells (a derivative of HEK293T cells).First, we identified the SAE2-associating proteins. Sample IDs: 92072 NRS control, 92073 antiSAE2 IP. Secondly, we identified proteins pulled-down by biotinylated mascRNA and mascRNA-3'CCA, using scrambled mascRNA oligo as a control. Sample IDs: 92199: scrambled mascRNA-Biotin control; 92200: mascRNA3'biotinTEG; 92201: mascRNA-CCA3'biotinTEGThirdly, we verified the specificity of SUMO1 IPs, by comparing two beads elution approaches: 1) by SUMO1 competitive peptide elution (processed gel pieces). Sample IDS: 99699-99704: Proteomic analysis of SDS PAGE gel pieces for SUMO1 IP and control IgG IP. (Details below) 2) urea eluates from the SUMO1-IPs. Sample IDs: 99705 control Rabbit IgG IP; 99706 SUMO1 IP Lastly, we used urea eluates from SUMO1-IPs from cells transfected with 5’P-mascRNA vs. 5’Pscrambled RNA. Sample IDs: 100479, 100480, 100481: Triplicates (1A, 1B, 1C) of control IgG IP from cells treated with scrambled mascRNA oligo (control IP)100482, 100483, 100484: Triplicates (3A, 3B, 3C) of control IgG IP from cells treated with mascRNA oligo (control IP)100485, 100486, 100487: Triplicates (2A, 2B, 2C) of SUMO1 IP from cells treated with scrambled mascRNA oligo (control transfection)100488, 100489, 100490: Triplicates (4A, 4B, 4C) of SUMO1 IP from cells treated with mascRNA oligo Sample details can be found in the file named Experimental_Design_Proteomics_ELIAPI_2024.txt below.

INSTRUMENT(S):

ORGANISM(S): Homo Sapiens (human)

TISSUE(S): Cell Culture

SUBMITTER: Eleni Liapi

LAB HEAD: Anastasios Vourekas

PROVIDER: PXD058139 | Pride | 2026-01-20

REPOSITORIES: Pride

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	100479.raw	Raw
	100480.raw	Raw
	100481.raw	Raw
	100482.raw	Raw
	100483.raw	Raw

Items per page:

1 - 5 of 51

Similar Datasets

Human SUMOylated Golgin45 CoIP-MS

Project description:HeLa cells expressing mCherry-Golgin45, Flag-UBC9-WT/DN and myc-SUMO1 were subjected to Co-IP experiment using RFP-beads (M165-8, MBL life science). Independent triplicates of mCherry-Golgin45 Co-IP experiments were prepared and analyzed by MS independently in a label free format.

2024-06-23 | PXD051237 | Pride

Whole genome RNA micro array analysis of Plasmodium berghei sporozoites infected host cells

Project description:mRNA Transcripts expression profile of Plasmodium berghei infected host HepG2 cells with and without SUMO1 over expression. To check the changes in the transcript profiles upon SUMO1 over expression which is responsible for Plasmodium berghei parasite's growth arrest in host HepG2 cells. Agilent one-color experiment, Organism: Homo sapiens, Custom Agilent 8x60k Human Whole Genome Microarray Gene expression (AMADID: 039494), Labeling kit: Agilent Quick-Amp labeling Kit (p/n5190-0442).

2016-09-01 | E-GEOD-72049 | biostudies-arrayexpress

Chromatin modification by SUMO-1 stimulates the promoters of translation machinery genes

Project description:We determined the occupancy of SUMO-1 on chromatin in HeLa cells by use of chromatin affinity purification coupled with next generation sequencing 18 samples examined in syncrhonized HeLa cells: Cells in G1, early S (S0)/mid (S3)/ late S phase (S6), and mitosis (M), triplicates for each sample. 1 ChIP-SUMO1 sample in S0, and 1 ChIP-IgG control

2012-10-02 | E-GEOD-41264 | biostudies-arrayexpress

SUMO and RNAPolII chromatin profiling in SUMOylation-competent and -deficient bone marrow derived dendritic cells unstimulated or stimulated with LPS

Project description:Purpose: To determine SUMO1 and SUMO2 chromatin profile in a static and dynamic manner in BMDC before and after LPS stimulation, and to determine RNAPolII chromatin occupancy in sumoylation-deficient BMDC compared to wild-type cells. Methods: SUMO1, SUMO2 and RNAPolII chromatin profiles were determined by sequencing BMDC chromatin immunoprecipitated with antibodies specific for SUMO1, SUMO2 and RNAPolII before and after LPS stimulation. Results: We show dynamic occupancy of three distal sites upstream of Ifnb1 gene by SUMO1 and SUMO2, as well as increased RNAPolII recruitment on selected genes. Conclusions: SUMO acts as a regulator of inflammatory and anti-viral gene programs. A study of SUMO and RNAPolII chromatin profile in Bone Marrow derived Dendritic Cells.

2015-12-14 | E-GEOD-66315 | biostudies-arrayexpress

Shg1p associated RNAs

Project description:RNA co-immunopurification with TAP-tagged Shg1p (a component of the Set1 histone methyltransferase complex, SET1C) from Saccharomyces cerevisiae. An untagged (BY4741) served as a control (Gerber et al. 2004). Cells were grown to mid-log phase in rich media and harvested by centrifugation. TAP-tagged Shg1 was affinity-purified from cell-free extracts with IgG sepharose and eluted with TEV protease. RNA was isolated from extract (=input) and from the purified protein sample with the RNAeasy Kit (Qiagen). RNAs were reverse transcribed using a mixture of oligo-dT and random nonamer oligos in the presence of amino-allyl dUTP/dNTP mixture. cDNAs were fluorescently labeled and hybridized on yeast oligo microarrays over night at 42 degrees in formamide-based hybridization buffer. For the method see experimental procedure for RNA IP (Gerber/Dichtl).

2009-08-31 | GSE15247 | GEO

A SUMOylated C-terminus fragment of glutamate transporter EAAT2 linked to inherited ALS mediates motor axon impairment

Project description:Downregulation of expression and activity levels of the astroglial glutamate transporter EAAT2 is thought to be implicated in motor neuron excitotoxicity in amyotrophic lateral sclerosis (ALS). We previously reported that EAAT2 is cleaved by caspase-3 at the cytosolic C-terminus domain, impairing the transport activity and generating a proteolytic fragment found to be SUMO1 conjugated (CTE-SUMO1). We show here that this fragment accumulates in the nucleus of spinal cord astrocytes in vivo throughout the disease stages of the SOD1-G93A mouse model of ALS. In vitro expression in spinal cord astrocytes of the C-terminus peptide of EAAT2 (CTE), which was artificially fused to SUMO1 (CTE-SUMO1fus) to mimic the endogenous SUMOylation reaction, recapitulates the nuclear accumulation of the fragment seen in vivo and causes caspase-3 activation and axonal growth impairment in motor neuron-derived NSC-34 cells and primary motor neurons co-cultured with CTE-SUMO1fus-expressing spinal cord astrocytes. This indicates that CTE-SUMO1fus could trigger non-cell autonomous mechanisms of neurodegeneration. Prolonged nuclear accumulation of CTE-SUMO1fus in astrocytes leads to their degeneration, although the time frame of the cell-autonomous toxicity is longer than the one for the indirect toxic effect on motor neurons. As more evidence on the implication of SUMO substrates in neurodegenerative diseases emerges, our observations strongly suggest that the nuclear accumulation in spinal cord astrocytes of a SUMOylated proteolytic fragment of the astroglial glutamate transporter EAAT2 could take part to the pathogenesis of ALS and suggest a novel, unconventional role for EAAT2 in motor neuron degeneration in ALS. Comparison is made between the toxic fragment (SUMO) and the same fragment without lysines that can be sumo-ylated (CTE). Four replicates have been performed for each sample group.

2011-07-19 | E-GEOD-26070 | biostudies-arrayexpress

Post-ICB treatment PDAC infiltrating T cells TCR profile

Project description:For the subcutaneous model, 5x105 KPC-Luc cells were injected subcutaneously near the right flank of female C57BL/6 mice. 6-7 days after tumor implantation mice were randomized into 4 treatment groups and treatedwith VIP-R antagonist and/or anti-PD-1. While scram+IgG control mice received scrambled peptide and isotype IgG, the VIP-R antagonist, anti-PD-1 and VIP-R antagonist and anti-PD-1 groups received VIP-R antagonist and IgG; scrambled peptide and anti-PD-1; and VIP-R antagonist and anti-PD-1, respectively. The treatment regimen involved administering 10μg of scrambled or VIP-R antagonist: ANT008, subcutaneously every day and 200μg of IgG or anti-PD-1 intraperitoneally once every three days, for a total of 10 days.

2022-09-19 | GSE213482 | GEO

ARF alters PAF1 complex integrity to selectively restrain a pro-growth transcriptional program to tune cell proliferation

Project description:Sample 1: LUM2_875391: IgG, as negative control Sample 2: LUM2_875392: ARF IP

2023-04-12 | MSV000091694 | MassIVE

Translational specialization in pluripotency by RBPMS poises future lineage-decisions

Project description:Immunoprecipitation for RBPMS in human embryonic stem cells. Triplicates of sheep anti-rabbit beads coupled with rabbit anti-RBPMS antibody were compared with and triplicates sheep anti-rabbit beads, which served as IgG control. Bands above heavy IgG, between heavy IgG and light IgG, below IgG and both IgG bands combined were excised from a gel and labeled via dimethyl labeling, before LC-MS run to increase detection resolution.

2023-10-26 | PXD032040 | Pride

Cell cycle motif decoy oligos

Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do).

2012-08-23 | GSE39572 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data