Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

0

Cell cycle motif decoy oligos


ABSTRACT: Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do). genetic_modification_design

ORGANISM(S): Homo sapiens

SUBMITTER: Adam Adler 

PROVIDER: E-GEOD-39572 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

altmetric image

Publications

Systematic functional characterization of cis-regulatory motifs in human core promoters.

Sinha Saurabh S   Adler Adam S AS   Field Yair Y   Chang Howard Y HY   Segal Eran E  

Genome research 20080206 3


A large number of cis-regulatory motifs involved in transcriptional control have been identified, but the regulatory context and biological processes in which many of them function are unknown. Here, we computationally identify the sets of human core promoters targeted by motifs, and systematically characterize their function by using a robust gene-set-based approach and diverse sources of biological data. We find that the target sets of most motifs contain both genes with similar function and g  ...[more]

Similar Datasets

2005-02-21 | E-GEOD-2193 | biostudies-arrayexpress
2010-06-24 | E-GEOD-15361 | biostudies-arrayexpress
2006-01-06 | E-GEOD-3988 | biostudies-arrayexpress
2006-01-27 | E-GEOD-4111 | biostudies-arrayexpress
2010-06-24 | E-GEOD-15297 | biostudies-arrayexpress
2008-02-07 | E-GEOD-7947 | biostudies-arrayexpress
2010-05-12 | E-GEOD-18151 | biostudies-arrayexpress
2007-09-13 | E-GEOD-9027 | biostudies-arrayexpress
2010-06-24 | E-GEOD-16107 | biostudies-arrayexpress
2010-06-24 | E-GEOD-16103 | biostudies-arrayexpress