Dataset Information

Fitness landscape of the MYC locus and a druggable ultraconserved RNA element revealed by CRISPR saturation mutagenesis (screen)

ABSTRACT: The genome is composed of relatively rare, typically conserved coding sequences and abundant, often less conserved noncoding sequences. The relative contributions of coding and noncoding regions to genetic information remain poorly understood. Here, we present a base-pair–resolution fitness landscape of the 10-kb MYC locus generated by CRISPR saturation mutagenesis using a near-PAMless, high-fidelity SpRY-Cas9. This unbiased analysis revealed that most (67%) functionally critical sequences are noncoding. Paradoxically, the phenotypic impact of noncoding sequences correlates inversely with evolutionary conservation, in part driven by rapidly evolving cis-regulatory DNA elements. We identified an ultraconserved 3’ UTR element required for cell growth in MYC-dependent cancer cells. Strikingly, targeting this RNA element with steric-blocking antisense oligonucleotides (ASOs) selectively eliminates MYC-dependent cancer cells by suppressing MYC function without reducing MYC protein abundance. Mechanistically, this 3′ UTR element promotes perinuclear localization of MYC mRNA, facilitating perinuclear translation and nuclear import of the short-lived MYC protein, enabling its function as a nuclear transcription factor. Together, these findings highlight noncoding sequences as key carriers of genetic information, define the functional architecture of the MYC locus, and uncover cancer-inhibitory ASOs targeting an RNA element

ORGANISM(S): Homo sapiens

PROVIDER: GSE317040 | GEO | 2026/09/23

REPOSITORIES: GEO

ACCESS DATA

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Project description:CCAT1-L is a highly expressed long noncoding RNA located in the colorectal cancer specific super enhance region about 500 kb upstream of MYC gene. Knockdown of CCAT1-L significantly down-regulated interaction frequency between CCAT1 and MYC locus and repress MYC expression, suggesting a long-range chromatin interaction between CCAT1-L and MYC locus maintained by CCAT1-L underlie the MYC regulation. To further validate this hypothesis, multiplexed 3C sequencing (3C-seq) was employed to evaluate chromatin interaction strength between CCAT1-L and MYC locus in CCAT1-L knockdown and scramble knockdown (Scr) HT29 cells. The 3C-Seq design and data analysis were performed according to Stadhouders et al, Nat Protoc. 2013, 8:509-524. A series of bait sequences accommodating different locus around CCAT1-L and MYC were selected. Through integrating with specific sample barcodes, bait-specific primer sets were designed to construct relevant 3C-seq libraries in CCAT1-L knockdown and scramble knockdown (Scr) HT29 samples. All of the 3C sample libraries from different treatment, including CCAT1-L knockdown and scramble knockdown (Scr), were then pooled together for high-throughput sequencing. Two technical 3C-seq were performed (CCAT1_myc_3C_1.txt.gz and CCAT1_myc_3C_2.txt.gz) and then combined together to get enough reads for further analysis. 3C-seq reads from different samples were divided according to sample barcodes (CCAT1-L knockdown: ATGTCA; Scr: GCCAAT) and different bait sequences, and then mapped to human reference genome to assess chromatin interaction strength between CCAT1-L and MYC locus in different treatments. In our study, one representative bait-specific sequencing data (CTTCTACTGATTGGCCCTAAACACTTTTCCAAAGCTT) was select to generate bedgraph files and upload to UCSC for visualization to show the chromatin interaction between CCAT1-L and Myc locus in CCAT1-L knockdown (CCAT1-L_knockdown_out.bedgraph) and scramble knockdown (Scr_out.bedgraph) samples.

Dataset Information

Fitness landscape of the MYC locus and a druggable ultraconserved RNA element revealed by CRISPR saturation mutagenesis (screen)

Dataset's files

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets