Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Human Embryonic Kidney(293T) Cells: Control vs. Transfected

ABSTRACT: Transcriptional profiling of Human Embryonic Kidney(293T) Cells comparing control untreated 293T cells with 293T cells transfected with A) pcDNA 3.0(-) vector[Invitrogen] (Mock) and B) Expression vector pcDNA 3.0(-) containing cloned Influenza virus H5N1and H11N1-NS1 (Non-Structural1) gene.

ORGANISM(S): Homo sapiens

PROVIDER: GSE39155 | GEO | 2014/07/14

SECONDARY ACCESSION(S): PRJNA170181

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

DNA methylation profiling for HEK-293T cells transfected with GFP and DMEΔ

Project description:Methylome data obtained from human embryonic kindey (HEK)-293T cells expressing a GFP (293T-GFP) or a truncated form of Arabidopsis DEMETER (DME) 5-methylcytosine (5mC) DNA glycosylase (293T-DMEΔ) analyzed on a Human Methylation 450K BeadChip platform (Illumina). These methylation array data revealed genome-wide DNA methylation patterns of the 293T-GFP cells (without direct 5mC excision activity) and 293T-DMEΔ cells (with artificially implemented direct 5mC excision activity).

2017-09-20 | GSE96864 | GEO

Tumorigenic effects of TLX over-expression in HEK 293T cells

Project description:Transcriptomic profiling to investigate the effect of TLX overexpression with an inducible vector system in the HEK 293T cell line

2021-01-21 | GSE120893 | GEO

Gene expression profile of 293T cells transfected with DOCK10

Project description:The goal of this study was to identify changes in the gene expression profile (GEP) of 293T cells in response to transfection with DOCK10 during 24 hours.

2019-04-11 | GSE114226 | GEO

Gene expression data for HEK-293T cells transfected with GFP control and plant derived DNA demethylase DMEΔ

Project description:Expression profiles of human embryonic kidney (HEK)-293T cells expressing a GFP (293T-GFP) or a truncated form of Arabidopsis DEMETER (DME) 5-methylcytosine (5mC) DNA glycosylase (293T-DMEΔ) analyzed on an Affymetrix Human Genome U133 Plus 2.0 Array Platform. These array data revealed differentially expressed genes (DEGs) between the 293T-GFP cells (without direct 5mC excision activity) and 293T-DMEΔ cells (with artificially implemented direct 5mC excision activity).

2017-09-20 | GSE96863 | GEO

Sox2 promotes malignancy in glioblastoma by regulating plasticity and astrocytic differentiation

Project description:Making use of a previously described isogenic cancer stem cells and serum differentiated cultures we show that Sox2 controls developmental stated specific programs in glioblastoma. Glioblastoma cells were cultured as control and with SOX2 knockdown to identify the scope of SOX2 interactions. The SOX2 knockdown were accomplished using two knockdown technologies. The knockdown cells were compared to controls, early passage, and scrambled controls. For Sox2 knockdown in low passage 10% FBS cells, the following oligonucleotides targeting human SOX2 coding sequence, or non-silencing control sequence, were cloned into BLOCK-iT Pol II miR RNAi expression vectors (Invitrogen), before cell transfection into GBM monolayer cells using Lipofectamine-2000 (Invitrogen): Sox2miRNA1R:5’CCTGTGCATGGGCTGTCTGCGCTGTCAGTCAGTGGCCAAAACAGCGCAGATGCAGCCCATGCAC Sox2miRNA1F:5’TGCTGTGCATGGGCTGCATCTGCGCTGTTTTGGCCACTGACTGACAGCGCAGACAGCC Sox2miRNA2R:5’CCTGAACCCATGGAGAAGAGCCAGTCAGTCAGTGGCCAAAACTGGCTCTTGGCTCCATGGGTTC Sox2miRNA2F:5’TGCTGAACCCATGGAGCCAAGAGCCAGTTTTGGCCACTGACTGACTGGCTCTTCTCCATGGGTT miRNAnegative:5’GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT Sox2 knockdown in neurospheres: GIPZ Lentiviral shRNAmir constructs targeting human Sox2 (clones V3LHS_404430 and V3LHS_404432) and non-silencing control (RHS4346) were obtained (Thermo Scientific Open Biosystems) and lentivirus were prepared according to the manufacturer’s instructions. Sox2 ectopic expression: Sox2 cDNA was subcloned from pCMV6-XL5-NM_002106.2 (Origene) into pcDNA 3.1 mammalian expression vector (Invitrogen), under control of constitutive CMV promoter. Plasmid DNA constructs were stably transfected into GBM monolayer cells using Lipofectamine-2000 (Invitrogen).

2014-07-22 | GSE51441 | GEO

ASLV vector infected 293t-TVA cells

Project description:Human 293T cells engineered to express the TVA receptor (see Mitchell et al., PLoS) infected with an ASLV vector. RNA isolated 48 hours later. ***PLEASE NOTE*** Series entries GSE1408 & GSE1409 no longer exist. All data discussed in the author's PLoS publication (PubMed ID 15314653) is available under GSE1407 & GSE1410. ***PLEASE NOTE*** Keywords: repeat sample

2004-05-19 | GSE1410 | GEO

Whole genome RNA-seq analysis of Wild type or Elf4-/- peritoneal macrophages and whole genome RNA-seq analysis of 293T cells transfected with miR-221 or empty vector.

Project description:Wild type or Elf4-/- peritoneal macrophages were infected with VSV, followed by whole genome RNA-seq analysis. 293T cells were transfected with miR-221 or empty vector, followed by whole genome RNA-seq analysis. Conclusions:Overexpression of miR-221 in cells facilitated viral infection and inhibited the production of IFNβ.

2017-11-21 | GSE107174 | GEO

Genome-wide analysis of gene expression and nuclear/cytoplasmic distribution by compound 1 treatment [293T-M]

Project description:Analysis of cellular response to DHODH inhibition at gene expression and nuclear/cytoplasmic distribution level. The NS1 protein of influenza virus is a major virulence factor essential for virus replication as it re-directs the host cell to promote viral protein expression. NS1 inhibits cellular mRNA processing and export, down-regulating host gene expression and enhancing viral gene expression. We report here the identification of a non-toxic quinoline carboxylic acid that reverts the inhibition of mRNA nuclear export by NS1, in the absence or presence of virus. This quinoline carboxylic acid directly inhibited dihydroorotate dehydrogenase (DHODH), a host enzyme required for *de novo* pyrimidine biosynthesis, and partially reduced pyrimidine levels. This effect induced NXF1 expression, which promoted mRNA nuclear export in the presence of NS1. The release of NS1-mediated mRNA export block by DHODH inhibition also occurred in the presence of VSV M protein, another viral inhibitor of mRNA export. This reversal of mRNA export block allowed expression of antiviral factors. Thus, pyrimidines play a necessary role in the inhibition of mRNA nuclear export by virulence factors. Five million 293T cells were non-transfected or transfected with 6ug of pEGFPN3-M-GFP for 16h. Then, cells were untreated or treated with compound 1(5uM) for 24h. RNA from total cell extracts or from nuclear or cytoplasmic fractions were obtained

2012-01-17 | E-GEOD-35112 | biostudies-arrayexpress

Human HEK 293T cells transfected with pEGFP-survivin gene

Project description:Transcriptional profiling of human embryonic kidney 293 cells comparing transfected control pEGFP-C1 (empty vector) with pEGFP (survivin vector).

2014-10-21 | GSE43817 | GEO

Transcription profiling of human 293T cells transfected with HIPK2 or an empty vector and exposed to either hypoxia or normoxia conditions

Project description:To determine the consequences of hypoxia-mediated HIPK2 clearance on gene expression, cells 293T were transfected with either the HIPK2 expression vector or the corresponding empty vector and then subjected to either hypoxia conditions (2% O2 for 6 h) or normoxia conditions. RNA total was extracted and later a study of the different gene expression under the four conditions detailed above was performed. The correct expression of HIPK2 was assessed by western blot in a small cell pool. The quality of RNA was quantified before the array study. <br><br>

2009-01-05 | E-MEXP-1896 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data